Guca2a (NM_008190) Mouse Untagged Clone
CAT#: MC200878
Guca2a (untagged) - Mouse guanylate cyclase activator 2a (guanylin) (Guca2a), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Guca2 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC012640 sequence for NM_008190
CCACGCGTCGCTGCATTGCATACTGCTACCATGAATGCCTGTGTGCTCTCTGTGCTGTGCCTCCTGGGTG CCTTGGCTGTCCTGGTAGAAGGGGTCACTGTGCAGGATGGAGACCTCTCCTTTCCTCTGGAGTCAGTGAA AAAACTTAAGGGTCTCCGCGAGGTACAGGAGCCCAGACTGGTGAGTCACAAGAAGTTTGCTCCCCGGCTT CTTCAGCCCGTGGCACCACAGCTATGTAGTAGCCACTCTGCACTTCCAGAAGCACTGAGGCCGGTCTGCG AGAAACCCAACGCCGAGGAGATCCTGCAGAGGCTAGAGGCCATTGCTCAGGACCCAAACACATGTGAGAT CTGTGCCTACGCTGCCTGTACGGGATGCTAGAGTGACATCGCTTGCCTTTCTCTCAGCCCATGTGGAAGC CCCTCTATCTTCTAGAAGTCACGAGGCTAACAAACTCATACCCTCAGCATCTATTGCCCTGCCACAGCGG GGAGGAGGCTGAGGAGACAGCTACCTGGAGAAGCCTTGCCTGAGGGCTATGTTAACCCTCAGCCAATAAA CCAAACTTCAGAACTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_008190 |
Insert Size | 351 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC012640, AAH12640 |
RefSeq Size | 613 bp |
RefSeq ORF | 351 bp |
Locus ID | 14915 |
UniProt ID | P33680 |
Gene Summary | Endogenous activator of intestinal guanylate cyclase. It stimulates this enzyme through the same receptor binding region as the heat-stable enterotoxins.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200499 | Guca2a (tGFP-tagged) - Mouse guanylate cyclase activator 2a (guanylin) (Guca2a) |
CNY 2,850.00 |
|
MR200499 | Guca2a (Myc-DDK-tagged) - Mouse guanylate cyclase activator 2a (guanylin) (Guca2a) |
CNY 1,200.00 |
|
MR200499L3 | Lenti ORF clone of Guca2a (Myc-DDK-tagged) - Mouse guanylate cyclase activator 2a (guanylin) (Guca2a) |
CNY 4,750.00 |
|
MR200499L4 | Lenti ORF clone of Guca2a (mGFP-tagged) - Mouse guanylate cyclase activator 2a (guanylin) (Guca2a) |
CNY 4,750.00 |