Sult2b1 (NM_017465) Mouse Untagged Clone
CAT#: MC200904
Sult2b1 (untagged) - Mouse sulfotransferase family, cytosolic, 2B, member 1 (Sult2b1), (10ug)
CNY 3,656.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI326997; BB173635; ST2B1; SULT2B |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC009811 sequence for NM_017465
CCACGCGTCCGGCTTCCCGCTCCCTCCCCCGCCTGCCCTGCGCTGCCAGCAGGGACTGCTGCCGGGAGCC CATCGGAGACCGCAGGTGGTGAATTCCCGGGATATCGTCGACCCACGCGTCCGCTACCTCCTGCCCTGCC CGCCATGGACGGGCCGCAGCCCCGCGCCCTGTGGAGCTCGTCTGAGAAAAATGTTTCCGAAATGAGCTGG AATTTTGGAGGTGAATACTTCAGATACAAAGGTATCCCTTTTCCTGTCGGCATGTACTCACCGGAGAGCC TCAGTCTGGCTGAGAACACTAGCAACGTGCGGGACGACGACATCTTCATTGTCACCTACCCCAAATCAGG TACCAACTGGATGATTGAGATCGTCTGCTTAATCCTGAAAGATGGGGATCCCTCGTGGATCCGATCGGAG CCCATCTGGCAACGTGCGCCCTGGTGCGAGACCATCATAAGCGCCTTCAATGTCTTAGACCGGCCCAGCC CCCGCATTATGAGCTCTCACCTCCCTATTGAACTCTTCACGAAGGCATTCTTCAGCTCCAAGGCTAAGGT GATTTACGTGGGCCGGAACCCCCGCGATGTCGTGGTCTCCCTCTATTATTATTCTAAGATTGCTGGGCAA TTAAAGGACCCTGGTACACCCGACCAGTTCCTTCAAAATTTCCTCAAAGGAGAAGTGCAGTTTGGCTCCT GGTTTGACCACATCAAGGGCTGGATCCGGATGCAGAACCAAGAGAACTTCCTGTTTATCACCTATGAGGA GCTGCAGCAGGACCTGCGAGGCTCCGTGCAACGCATCTGTGAGTTCCTGGGCCGGCCACTGGGTGAAGAG GCCCTGAGCTCTGTGGTGGCCCACTCAGCCTTTGCTGCCATGAAGGCCAATACCATGTCCAACTACTCGC TGCTGCCGGCCAGCCTGCTGGACCACCGCCAGGGGGAGTTCCTGCGCAAAGGGATCAGTGGCGACTGGAA GAACCACTTCACTGTGGCCCAGAGTGAGGCTTTTGACAGTGTTTACCGAGAGCAAATGCACGGGGTGCAG AGGTTCCCCTGGGACACGTCTGAAGAGGATAGCAGCCCTGATGGCCAGCCTGACCCTGAGCCCAGCCCCA GCCCAGCTTCTGATGACCCCAACCCAGGATCCTCACAATAAACTTATCACTCCAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_017465 |
Insert Size | 1017 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC009811, AAH09811 |
RefSeq Size | 1206 bp |
RefSeq ORF | 1017 bp |
Locus ID | 54200 |
UniProt ID | O35400 |
Gene Summary | Sulfotransferase that utilizes 3'-phospho-5'-adenylyl sulfate (PAPS) as sulfonate donor to catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs and xenobiotic compounds. Sulfonation increases the water solubility of most compounds, and therefore their renal excretion, but it can also result in bioactivation to form active metabolites. Sulfates hydroxysteroids such as dehydroepiandrosterone. Isoform 1 is required for production of cholesterol sulfate essential for normal skin development whereas isoform 2 produces pregnenolone sulfate, an essential neurosteroid during development of the central nervous system. Plays a role in epidermal cholesterol metabolism and in the regulation of epidermal proliferation and differentiation.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG205040 | Sult2b1 (tGFP-tagged) - Mouse sulfotransferase family, cytosolic, 2B, member 1 (Sult2b1) |
CNY 3,710.00 |
|
MR205040 | Sult2b1 (Myc-DDK-tagged) - Mouse sulfotransferase family, cytosolic, 2B, member 1 (Sult2b1) |
CNY 3,656.00 |
|
MR205040L1 | Lenti ORF clone of Sult2b1 (Myc-DDK-tagged) - Mouse sulfotransferase family, cytosolic, 2B, member 1 (Sult2b1) |
CNY 5,230.00 |
|
MR205040L2 | Lenti ORF clone of Sult2b1 (mGFP-tagged) - Mouse sulfotransferase family, cytosolic, 2B, member 1 (Sult2b1) |
CNY 5,230.00 |
|
MR205040L3 | Lenti ORF clone of Sult2b1 (Myc-DDK-tagged) - Mouse sulfotransferase family, cytosolic, 2B, member 1 (Sult2b1) |
CNY 5,230.00 |
|
MR205040L4 | Lenti ORF clone of Sult2b1 (mGFP-tagged) - Mouse sulfotransferase family, cytosolic, 2B, member 1 (Sult2b1) |
CNY 5,230.00 |
其它Sult2b1产品