Atp6v1f (NM_025381) Mouse Untagged Clone
CAT#: MC201199
Atp6v1f (untagged) - Mouse ATPase, H+ transporting, lysosomal V1 subunit F (Atp6v1f), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110004G16Rik |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC016553 sequence for NM_025381
CGGACGCGTGGGCGGACGCGTGGGTCGTCTGCCCGGCGGACAGGATGGCGGGCAGAGGTAAGCTAATCGC GGTGATTGGAGACGAGGACACGGTGACTGGTTTCCTGTTGGGCGGCATAGGGGAGCTAAACAAGAACCGC CACCCTAATTTCCTGGTAGTGGAGAAGGATACCACCATCAATGAGATCGAAGACACTTTCAGGCAATTTC TAAACAGGGATGACATTGGCATCATTCTCATCAACCAGTACATCGCAGAGATGGTTCGGCACGCCCTGGA TGCCCACCAGAGGTCCATTCCAGCTGTCCTGGAGATCCCGTCCAAGGAGCATCCCTACGATGCAGCCAAA GACTCCATCCTGCGCAGGGCCAAGGGCATGTTCACCGCTGAAGACCTGCGCTAGGGCTGCTCAGCCCTCA GCCCTCCTCATCACCAGGCCTCTCCTGGTTTGCCATGCTCTATTTAAGTGTCAAGCCTTGGTTTCCAGCC CCTCCCTTCCTCTTCACTGAGTGGCTCGTAAGCTGTTGGGGTTCGGTTGTTCAGGTCTAGGCTGGGTAGA GAAAGAAAGCCCAACTGTTTCTCCACTGCCTCCTCCCTGTGCTGTTAATAGTATCGTTGTTGATATTAAA GGAATTATTCTCTCCAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_025381 |
Insert Size | 360 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC016553, AAH16553 |
RefSeq Size | 660 bp |
RefSeq ORF | 360 bp |
Locus ID | 66144 |
UniProt ID | Q9D1K2 |
Gene Summary | Subunit of the peripheral V1 complex of vacuolar ATPase essential for assembly or catalytic function. V-ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200560 | Atp6v1f (tGFP-tagged) - Mouse ATPase, H+ transporting, lysosomal V1 subunit F (Atp6v1f) |
CNY 2,850.00 |
|
MR200560 | Atp6v1f (Myc-DDK-tagged) - Mouse ATPase, H+ transporting, lysosomal V1 subunit F (Atp6v1f) |
CNY 1,200.00 |
|
MR200560L3 | Lenti ORF clone of Atp6v1f (Myc-DDK-tagged) - Mouse ATPase, H+ transporting, lysosomal V1 subunit F (Atp6v1f) |
CNY 4,750.00 |
|
MR200560L4 | Lenti ORF clone of Atp6v1f (mGFP-tagged) - Mouse ATPase, H+ transporting, lysosomal V1 subunit F (Atp6v1f) |
CNY 4,750.00 |
其它Atp6v1f产品