United States
Germany
Japan
United Kingdom
China
Myl6 (NM_010860) Mouse Untagged Clone
CAT＃: MC201301
Myl6 (untagged) - Mouse myosin, light polypeptide 6, alkali, smooth muscle and non-muscle (Myl6), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | ESMLC; LC17; LC17-GI; MLC-3; MLC1SM; Myln |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC026760 sequence for NM_010860
GCTCAGCAGCCAAGATGTGTGACTTCACCGAGGACCAGACCGCAGAATTCAAGGAGGCTTTCCAGCTGTT TGACCGAACAGGTGATGGCAAGATCCTGTACAGCCAGTGTGGGGATGTGATGCGGGCCCTGGGCCAGAAC CCTACCAACGCCGAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGATGAGATGAATGTGAAGGTGCTGG ACTTTGAGCACTTCCTGCCCATGCTGCAGACCGTGGCCAAGAACAAGGACCAGGGAACCTACGAGGATTA TGTTGAAGGCCTTCGTGTGTTTGACAAGGAAGGAAATGGCACCGTCATGGGTGCTGAAATCCGTCATGTC CTAGTCACACTGGGCGAGAAGATGACAGAGGAAGAAGTAGAGATGCTAGTGGCGGGGCATGAGGACAGCA ATGGTTGCATCAACTATGAAGAGCTTGTCCGGATGGTGCTGAATGGCTGAGGACATTCTGTATCCCGAGT CTGTTCCTTGCCCAGTGTGATTTCTGTGTGGCTCCAGAGGCTCCCCTGTCACAGCACCTTGCCCATTTGG TTTCTTTTGGATGATGTTTGCCTTCCCCAAATAAAATTTGCTCTCTTTGCCCTCCAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_010860 |
| Insert Size | 456 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC026760, AAH26760 |
| RefSeq Size | 657 bp |
| RefSeq ORF | 456 bp |
| Locus ID | 17904 |
| UniProt ID | Q60605 |
| Gene Summary | Regulatory light chain of myosin. Does not bind calcium.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) lacks an alternate exon in the 3' coding region, resulting in a frameshift and a novel 3' UTR, compared to variant 1. The encoded isoform (MLC3sm, also known as LC17B and LC17-sm) has a distinct C-terminus and is shorter than isoform a. Isoform MLC3sm and MLC3nm are the same length but differ in their C-termini. Isoforms b and c are the same length but differ in their C-termini. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201079 | Myl6 (tGFP-tagged) - Mouse myosin, light polypeptide 6, alkali, smooth muscle and non-muscle (Myl6) |
CNY 2,850.00 |
|
| MR201079 | Myl6 (Myc-DDK-tagged) - Mouse myosin, light polypeptide 6, alkali, smooth muscle and non-muscle (Myl6) |
CNY 1,200.00 |
|
| MR201079L3 | Lenti ORF clone of Myl6 (Myc-DDK-tagged) - Mouse myosin, light polypeptide 6, alkali, smooth muscle and non-muscle (Myl6) |
CNY 4,750.00 |
|
| MR201079L4 | Lenti ORF clone of Myl6 (mGFP-tagged) - Mouse myosin, light polypeptide 6, alkali, smooth muscle and non-muscle (Myl6) |
CNY 4,750.00 |
