Gng11 (NM_025331) Mouse Untagged Clone
CAT#: MC201520
Gng11 (untagged) - Mouse guanine nucleotide binding protein (G protein), gamma 11 (Gng11), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 0610037B21Rik |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC039062 sequence for NM_025331
ACCTGGTCCTGTTCCTGCAGGGTCTGCAGCCTGCCCAGAGCAGCCAGGAGGATGTCCCATATTTAGGCAG ACTGCCTGGCTACAGGGCTGCTGCGGCCTGGAGAAGCCGCCCTGAAGTTGGTTGGAGTCTGGGAAAGGCC ATCGGGAGCAGGCTTGGGCAGGAAGCCGAGCCCCCGGGGAGCTGGGAGCTGCGGTTCCCGAGCCAGTCAC GTCCTGCGCGCGGGGGGCGGTAGCCTGGGCCCGCGGGTATTTGGGGAAGCGTCCCAGTTCTAGGCGCTTC CAGTGGCTCCCTTGCACAAGTGACTTCTGGGCCCAGTTCTGGGGCAAAGATGCCTGCCCTTCACATCGAG GATCTGCCGGAAAAGGAAAAACTGAAGATGGAGGTTGAGCAACTTCGCAAAGAAGTCAAGTTGCAGAGAC AACAGGTATCTAAATGTTCTGAGGAAATAAAGAACTACATTGAAGAACGTTCTGGAGAGGATCCTCTGGT AAAGGGAATCCCAGAAGACAAGAATCCCTTCAAAGAAAAGGGCAGCTGTGTCATTTCATAAGTAACTCTG GGGGAGGGAAATTCTGTTCTTTTGTTTAATTTTCCCCCAAATGAAGCCAAAGTGTGTGTTGAAGAACTGA GAAAAAATAAAATCGAGAAAAAGACTGTCATATAAGCACTCTCCAAGCAGTTGGGGTGTGAATCATACCT GCTTCTCACCTTGGCTCCCCACACACTCTCTCTCAGAGGAGAGCATCTGATTGCAGTTATGGAATGAAGG CATGGCTCCCCCACTTTCAGTATACTCCTTGCTGTCTCCAATAAAGTTTTATCTTGGAAAAATCAAAAAA AAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_025331 |
Insert Size | 222 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC039062, AAH39062 |
RefSeq Size | 849 bp |
RefSeq ORF | 222 bp |
Locus ID | 66066 |
UniProt ID | P61953 |
Gene Summary | Guanine nucleotide-binding proteins (G proteins) are involved as a modulator or transducer in various transmembrane signaling systems. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200085 | Gng11 (tGFP-tagged) - Mouse guanine nucleotide binding protein (G protein), gamma 11 (Gng11) |
CNY 2,850.00 |
|
MR200085 | Gng11 (Myc-DDK-tagged) - Mouse guanine nucleotide binding protein (G protein), gamma 11 (Gng11) |
CNY 1,200.00 |
|
MR200085L3 | Lenti ORF clone of Gng11 (Myc-DDK-tagged) - Mouse guanine nucleotide binding protein (G protein), gamma 11 (Gng11) |
CNY 4,750.00 |
|
MR200085L4 | Lenti ORF clone of Gng11 (mGFP-tagged) - Mouse guanine nucleotide binding protein (G protein), gamma 11 (Gng11) |
CNY 4,750.00 |