Isg20 (NM_020583) Mouse Untagged Clone
CAT#: MC201624
Isg20 (untagged) - Mouse interferon-stimulated protein (Isg20), transcript variant 1, (10ug)
CNY 2,400.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 20kDa; 1600023I01Rik; 2010107M23Rik; DnaQL; HEM45 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC022751 sequence for NM_020583
GCCCTGACTCAACCTGCCAGCCCCCTTACCTGGCCAGCCTTGAGGAGATGGAACAGCCCAGGCTACAAGG CCTGCCCCCACTCCTCAACTTCCCTTGATAATGAACCAGAAACTGAAACTAAAACAGGCAGGCTCCCCGT TAGAGATGAGTCACTTCCCAAAGTGACTGAAGTAGCCGAGAAGTGGAAACAGAGGGGCAGAAGAGAACCC AGGGCACTGAGACAGGGCTTTCTGAGGGTCGCCAAGGAGCATGGCAGGCATCCCAGAGGTGGTGGCCATG GACTGTGAGATGGTGGGGCTTGGGCCTCAAAGGGTGAGTGGCCTCGCCCGCTGCAGCATTGTGAACATCC ATGGCGCAGTCCTGTATGACAAGTACATCCGACCCGAGGGAGAGATCACGGACTACAGAACCCAAGTCAG CGGGGTCACGCCTCAGCACATGGTGAGGGCCACGCCATTTGGTGAAGCCAGGCTAGAGATCCTGCAGCTT CTGAAAGGCAAGCTGGTGGTGGGCCATGACCTGAAGCACGACTTCAATGCCCTGAAGGAGGATATGAGCA AGTACACCATCTATGACACGTCCACAGACAGGCTGCTGTGGCATGAGGCCAAGCTGCAGTACTACAGCCG AGTGTCCCTGAGGCTGCTGTGTAAGCGCCTGCTACACAAGAACATCCAGAACAACTGGCGGGGCCACTGC TCTGTGGAAGATGCCAGGGCCACAATGGAGCTCTACAAAATCTCTCAGCGACTCAGAGCCCAGCGAGGGC TGCCTTGCCCTGGGACGTCAGACTGAACTTCATCCTCATCCAGGGTTAGAAGCTGCCACTCCTCAAGTTC TCCATGAATGAGACCTGTTTCTAACAACCACTGCCACCAACCACCGCAATGTGTAAAACCAAGAACACTC CCCCATTACAGCAACTCTCTTGCTTTGAGGCAAAAACAACAACAACAACAACAACAACAACAGCAAAACC AAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_020583 |
Insert Size | 546 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC022751, AAH22751 |
RefSeq Size | 996 bp |
RefSeq ORF | 546 bp |
Locus ID | 57444 |
UniProt ID | Q9JL16 |
Gene Summary | Interferon-induced antiviral exoribonuclease that acts on single-stranded RNA and also has minor activity towards single-stranded DNA. Exhibits antiviral activity against RNA viruses in an exonuclease-dependent manner. May also play additional roles in the maturation of snRNAs and rRNAs, and in ribosome biogenesis (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) differs in the 5' UTR and uses an alternate splice junction at the 5' end of the last exon compared to variant 4. The resulting isoform (b) has a shorter and distinct C-terminus compared to isoform a. Variants 1, 2, and 3 all encode the same isoform (b). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201635 | Isg20 (tGFP-tagged) - Mouse interferon-stimulated protein (Isg20) |
CNY 2,850.00 |
|
MG218182 | Isg20 (tGFP-tagged) - Mouse interferon-stimulated protein (Isg20) transcript variant 1, (10ug) |
CNY 2,850.00 |
|
MR218182 | Isg20 (Myc-DDK-tagged) - Mouse interferon-stimulated protein (Isg20), transcript variant 1 |
CNY 2,400.00 |
|
MR218182L3 | Lenti ORF clone of Isg20 (Myc-DDK-tagged) - Mouse interferon-stimulated protein (Isg20), transcript variant 1 |
CNY 4,750.00 |
|
MR218182L4 | Lenti ORF clone of Isg20 (mGFP-tagged) - Mouse interferon-stimulated protein (Isg20), transcript variant 1 |
CNY 4,750.00 |