United States
Germany
Japan
United Kingdom
China
Bst2 (NM_198095) Mouse Untagged Clone
CAT＃: MC201626
Bst2 (untagged) - Mouse bone marrow stromal cell antigen 2 (Bst2), (10ug)
CNY 2,400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2310015I10Rik; Bst-2; C87040; CD317; DAMP-1; GREG |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC027328 sequence for NM_198095
GACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGGACGGATCACATGGCGCCCTCTTTCTATCACTATCT GCCCGTGCCCATGGATGAGATGGGGGGGAAGCAAGGATGGGGCAGCCACCGGCAGTGGCTGGGGGCCGCG ATCTTGGTGGTCCTGTTCGGGGTTACCTTAGTCATCCTGACAATCTACTTCGCCGTCACAGCGAACAGCG TGGCCTGTAGAGACGGGTTGCGAGCGCAGGCTGAGTGCCGGAACACCACGCACCTGTTGCAGCGCCAGCT CACCCGCACCCAGGACAGTCTGCTGCAGGCCGAGACACAGGCAAACTCCTGCAACCTGACCGTGGTGACC CTTCAGGAGTCCCTGGAGAAGAAGGTGTCTCAAGCCCTGGAGCAGCAGGCCCGCATCAAGGAGCTTGAGA ATGAAGTCACGAAGCTGAACCAGGAGCTGGAGAATCTGAGGATCCAAAAGGAGACTTCTAGCACAGTGCA GGTGAACTCTGGCAGCTCCATGGTGGTCTCCAGCCTACTGGTGCTCAAAGTGTCACTGTTCCTGCTCTTT TGAGGACTCATTAGTTGGCAGGTCACAGTTGTTTGAAGTCACTATGGGTCATAGTGACTCTGGAGAGGTC CTGGCAGCCCTGAGGATGTGGAAACCACTAGGGGGCTCCAGATTGGGTCTTCCTCCGCAGAACTTTAGGA CTGGGGAGTGGGGAGGGAGTTCTGCTTTATTGCTTTTGCAGTTATTGGGGGGGGTCACATATTTCTGGTG TCTTTGACCTGGAAAAATAAAGTAATTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_198095 |
| Insert Size | 519 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC027328, AAH27328 |
| RefSeq Size | 900 bp |
| RefSeq ORF | 519 bp |
| Locus ID | 69550 |
| UniProt ID | Q8R2Q8 |
| Gene Summary | IFN-induced antiviral host restriction factor which efficiently blocks the release of diverse mammalian enveloped viruses by directly tethering nascent virions to the membranes of infected cells. Acts as a direct physical tether, holding virions to the cell membrane and linking virions to each other. The tethered virions can be internalized by endocytosis and subsequently degraded or they can remain on the cell surface. In either case, their spread as cell-free virions is restricted. Its target viruses belong to diverse families, including retroviridae: human immunodeficiency virus type 1 (HIV-1), mouse mammary tumor virus (MMTV) and murine leukemia virus (MLV), filoviridae: ebola virus (EBOV), arenaviridae: lassa virus (LASV), and rhabdoviridae: vesicular stomatitis virus (VSV). Can inhibit cell surface proteolytic activity of MMP14 causing decreased activation of MMP15 which results in inhibition of cell growth and migration. Can stimulate signaling by LILRA4/ILT7 and consequently provide negative feedback to the production of IFN by plasmacytoid dendritic cells in response to viral infection. Plays a role in the organization of the subapical actin cytoskeleton in polarized epithelial cells.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201461 | Bst2 (tGFP-tagged) - Mouse bone marrow stromal cell antigen 2 (Bst2) |
CNY 4,000.00 |
|
| MR201461 | Bst2 (Myc-DDK-tagged) - Mouse bone marrow stromal cell antigen 2 (Bst2) |
CNY 2,400.00 |
|
| MR201461L3 | Lenti ORF clone of Bst2 (Myc-DDK-tagged) - Mouse bone marrow stromal cell antigen 2 (Bst2) |
CNY 4,750.00 |
|
| MR201461L4 | Lenti ORF clone of Bst2 (mGFP-tagged) - Mouse bone marrow stromal cell antigen 2 (Bst2) |
CNY 4,750.00 |
