United States
Germany
Japan
United Kingdom
China
Bex3 (NM_009750) Mouse Untagged Clone
CAT＃: MC201736
Ngfrap1 (untagged) - Mouse nerve growth factor receptor (TNFRSF16) associated protein 1 (Ngfrap1), transcript variant 1, (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AL033356; DXWsu67e; Gcap27; Nade; Ngfrap1 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC027815 sequence for NM_009750
CCACGCGTCCGCCCACGCGTCCGGAGCTCCTCTGCGCGCGGCGGGCTGGCAGCGGGCCCGAGGCGAGCGG GACAGATTGACTGGAAGCCGAGAGTCCAGGCGGCAGCGGGAATTGACAGGAGGACTACGCCGCAAGGGAT AGGCCCAGAATAGCAACCAGGAAACAAAATCTCATCATGGCCAATGTCCACCAGGAAAACGAAGAGATGG AGCAGCCCCTGCAGAATGGACAGGAAGACCGCCCTGTGGGAGGAGGTGAGGGCCACCAGCCTGCTGCAAA CAACAACAACAACAACCACAACCATAACCACAACCACCACCGAAGAGGCCAGGCTCGCCGACTTGCCCCT AACTTCCGATGGGCCATTCCCAACAGGCAGATGAATGACGGGTTGGGTGGAGATGGAGATGATATGGAAA TGTTCATGGAGGAGATGAGAGAGATCCGGAGAAAGCTTAGGGAGCTACAGCTGAGAAATTGTCTACGCAT CCTTATGGGGGAGCTGTCTAACCACCACGATCACCATGATGAATTCTGCCTTATGCCTTGACTTCGGTCA TTCCCCCCTGAGATCCATACTGTGACTCCCGCTGTAGCCCTTTTCCTCGCATTTTCCTGACATGCCTTTA ATGACCCGTTTGTGGTGAGCCTTGTGTTATTTCCATGCCATGTGCCAGGTGGGGCTTGTGTTGCCAGCTT CTAATTGGAGATTGCCTTCCCACTCAGTGTGAGTTTCTGTCAACAGTGCAGTGTTGCCCATTAGCATGGA AAGCAATGTCAAGTCAATAAAGCAACTGAATAATCAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_009750 |
| Insert Size | 375 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC027815, AAH27815 |
| RefSeq Size | 820 bp |
| RefSeq ORF | 375 bp |
| Locus ID | 12070 |
| UniProt ID | Q9WTZ9 |
| Gene Summary | May be a signaling adapter molecule involved in p75NTR-mediated apoptosis induced by NGF. Plays a role in zinc-triggered neuronal death.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1 and 2 both encode isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG222199 | Ngfrap1 (tGFP-tagged) - Mouse nerve growth factor receptor (TNFRSF16) associated protein 1 (Ngfrap1) transcript variant 1, (10ug) |
CNY 2,090.00 |
|
| MR222199 | Ngfrap1 (Myc-DDK-tagged) - Mouse nerve growth factor receptor (TNFRSF16) associated protein 1 (Ngfrap1), transcript variant 1 |
CNY 1,900.00 |
|
| MR222199L3 | Lenti ORF clone of Ngfrap1 (Myc-DDK-tagged) - Mouse nerve growth factor receptor (TNFRSF16) associated protein 1 (Ngfrap1), transcript variant 1 |
CNY 3,800.00 |
|
| MR222199L4 | Lenti ORF clone of Ngfrap1 (mGFP-tagged) - Mouse nerve growth factor receptor (TNFRSF16) associated protein 1 (Ngfrap1), transcript variant 1 |
CNY 3,800.00 |
