Hopx (NM_175606) Mouse Untagged Clone
CAT#: MC201799
Hopx (untagged) - Mouse HOP homeobox (Hopx), transcript variant 1, (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110018K11Rik; 1200015P04Rik; 2300002F06Rik; AI848177; AW490897; Cameo; Hdop; Hod; Hop |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC024546 sequence for NM_175606
CCGGATCTCCGGAGGCAGCACTTGAGGCGCTTCCTCAGTATACTGTCCCCTCGGAGTGTCAGGCGGGAGG CGTCTTCTTCCTCCTCTCCATCCTTAGTCAGACGCGCACGGACCATGTCGGCGCAGACCGCGAGCGGCCC CACGGAGGACCAGGTGGAGATCCTGGAGTACAACTTCAACAAGGTCAACAAGCACCCGGACCCCACCACG CTGTGCCTCATCGCAGCCGAGGCGGGTCTCACGGAGGAGCAGACGCAGAAATGGTTTAAGCAGCGCCTGG CAGAGTGGCGGCGGTCAGAAGGCTTGCCTTCGGAATGCAGATCTGTTACGGACTAGGGAGCCAGGCCCTT GAGCTTGCTCTTGGAACTCCATCTCTTCTTCCTTCCCTCGGCTTACCCAGGCTGTTTTGATGTTTCAGTG CAGTGTTGAATGTCTCATTGTTTTGCTGTCCTGCTATTTAACACAATGTGTTTTTTTTTTTATGTATATA ACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_175606 |
Insert Size | 222 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC024546, AAH24546 |
RefSeq Size | 544 bp |
RefSeq ORF | 222 bp |
Locus ID | 74318 |
UniProt ID | Q8R1H0 |
Gene Summary | Atypical homeodomain protein which does not bind DNA and is required to modulate cardiac growth and development. Acts via its interaction with SRF, thereby modulating the expression of SRF-dependent cardiac-specific genes and cardiac development. Prevents SRF-dependent transcription either by inhibiting SRF binding to DNA or by recruiting histone deacetylase (HDAC) proteins that prevent transcription by SRF. Overexpression causes cardiac hypertrophy (PubMed:12297045, PubMed:12297046). Acts as a co-chaperone for HSPA1A and HSPA1B chaperone proteins and assists in chaperone-mediated protein refolding (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200084 | Hopx (tGFP-tagged) - Mouse homeobox only domain (Hod) |
CNY 2,850.00 |
|
MG223455 | Hopx (tGFP-tagged) - Mouse HOP homeobox (Hopx) transcript variant 1, (10ug) |
CNY 2,850.00 |
|
MR223455 | Hopx (Myc-DDK-tagged) - Mouse HOP homeobox (Hopx), transcript variant 1 |
CNY 1,200.00 |
|
MR223455L3 | Lenti ORF clone of Hopx (Myc-DDK-tagged) - Mouse HOP homeobox (Hopx), transcript variant 1 |
CNY 4,750.00 |
|
MR223455L4 | Lenti ORF clone of Hopx (mGFP-tagged) - Mouse HOP homeobox (Hopx), transcript variant 1 |
CNY 4,750.00 |