United States
Germany
Japan
United Kingdom
China
Avp (NM_009732) Mouse Untagged Clone
CAT＃: MC202013
Avp (untagged) - Mouse arginine vasopressin (Avp), (10ug)
CNY 2,400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Vp; Vsp |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC051997 sequence for NM_009732
ACAGTGCCCACCTATGCTCGCCAGGATGCTCAACACTACGCTCTCCGCTTGTTTCCTGAGCCTGCTGGCC TTCTCCTCCGCCTGCTACTTCCAGAACTGCCCAAGAGGCGGCAAGAGGGCCATCTCTGACATGGAGCTGA GACAGTGTCTCCCCTGCGGCCCGGGCGGCAAAGGACGCTGCTTCGGACCAAGCATCTGCTGCGCGGACGA GCTGGGCTGCTTCGTGGGCACCGCCGAGGCGCTGCGCTGCCAGGAGGAGAACTACCTGCCCTCGCCCTGC CAGTCCGGCCAGAAGCCCTGCGGGAGCGGGGGCCGCTGCGCCGCCGTGGGCATCTGCTGCAGCGACGAGA GCTGCGTGGCCGAGCCCGAGTGCCACGACGGTTTTTTCCGCCTCACCCGCGCTCGGGAGCCAAGCAACGC CACACAGCTGGACGGCCCTGCTCGGGCGCTGCTGCTAAGGCTGGTACAGCTGGCTGGGACACGGGAGTCC GTGGATTCTGCCAAGCCCCGGGTCTACTGAGCCATCGCCCCCACGCCTCGCCCCTACAGCATGGAAAATA AACTTTTAAAAACTGCAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | AscI-NotI |
| ACCN | NM_009732 |
| Insert Size | 507 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC051997, AAH51997 |
| RefSeq Size | 597 bp |
| RefSeq ORF | 507 bp |
| Locus ID | 11998 |
| UniProt ID | P35455 |
| Gene Summary | This gene encodes a member of the vasopressin/oxytocin family and preproprotein that is proteolytically processed to generate multiple protein products. These products include the neuropeptide hormone arginine vasopressin, and two other peptides, neurophysin 2 and copeptin. Arginine vasopressin binds to vasopressin receptors and functions as a vasopressor, to constrict blood vessels and increase blood pressure, and as an antidiuretic, to reduce the production of urine. Neurophysin 2 functions as a carrier protein in the transport of arginine vasopressin. This gene is present in a gene cluster with the related gene oxytocin on chromosome 2. [provided by RefSeq, Aug 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201383 | Avp (tGFP-tagged) - Mouse arginine vasopressin (Avp) |
CNY 2,850.00 |
|
| MR201383 | Avp (Myc-DDK-tagged) - Mouse arginine vasopressin (Avp) |
CNY 2,400.00 |
|
| MR201383L3 | Lenti ORF clone of Avp (Myc-DDK-tagged) - Mouse arginine vasopressin (Avp) |
CNY 4,750.00 |
|
| MR201383L4 | Lenti ORF clone of Avp (mGFP-tagged) - Mouse arginine vasopressin (Avp) |
CNY 4,800.00 |
