Avp (NM_009732) Mouse Untagged Clone

CAT#: MC202013

Avp (untagged) - Mouse arginine vasopressin (Avp), (10ug)



  "NM_009732" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Vp; Vsp
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC051997 sequence for NM_009732
ACAGTGCCCACCTATGCTCGCCAGGATGCTCAACACTACGCTCTCCGCTTGTTTCCTGAGCCTGCTGGCC TTCTCCTCCGCCTGCTACTTCCAGAACTGCCCAAGAGGCGGCAAGAGGGCCATCTCTGACATGGAGCTGA GACAGTGTCTCCCCTGCGGCCCGGGCGGCAAAGGACGCTGCTTCGGACCAAGCATCTGCTGCGCGGACGA GCTGGGCTGCTTCGTGGGCACCGCCGAGGCGCTGCGCTGCCAGGAGGAGAACTACCTGCCCTCGCCCTGC CAGTCCGGCCAGAAGCCCTGCGGGAGCGGGGGCCGCTGCGCCGCCGTGGGCATCTGCTGCAGCGACGAGA GCTGCGTGGCCGAGCCCGAGTGCCACGACGGTTTTTTCCGCCTCACCCGCGCTCGGGAGCCAAGCAACGC CACACAGCTGGACGGCCCTGCTCGGGCGCTGCTGCTAAGGCTGGTACAGCTGGCTGGGACACGGGAGTCC GTGGATTCTGCCAAGCCCCGGGTCTACTGAGCCATCGCCCCCACGCCTCGCCCCTACAGCATGGAAAATA AACTTTTAAAAACTGCAAAAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
ACCN NM_009732
Insert Size 507 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC051997, AAH51997
RefSeq Size 597 bp
RefSeq ORF 507 bp
Locus ID 11998
UniProt ID P35455
Gene Summary This gene encodes a member of the vasopressin/oxytocin family and preproprotein that is proteolytically processed to generate multiple protein products. These products include the neuropeptide hormone arginine vasopressin, and two other peptides, neurophysin 2 and copeptin. Arginine vasopressin binds to vasopressin receptors and functions as a vasopressor, to constrict blood vessels and increase blood pressure, and as an antidiuretic, to reduce the production of urine. Neurophysin 2 functions as a carrier protein in the transport of arginine vasopressin. This gene is present in a gene cluster with the related gene oxytocin on chromosome 2. [provided by RefSeq, Aug 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...