United States
Germany
Japan
United Kingdom
China
Mgmt (NM_008598) Mouse Untagged Clone
CAT＃: MC202089
Mgmt (untagged) - Mouse O-6-methylguanine-DNA methyltransferase (Mgmt), (10ug)
CNY 2,400.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Agat; AGT; AI267024 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC031888 sequence for NM_008598
AAAACTTGTGTACCGTTCCCCGTTGCTGTCTGCAGTTTGCAAGCTGGAACTTGGCAGAATGGCTGAGACC TGCAAAATGAAATACTCAGTGTTGGACAGCCCTTTGGGGAAGATGGAGCTGTCTGGCTGTGAGCGAGGCC TGCATGGGATACGGTTGCTCAGTGGGAAGACCCCAAACACTGACCCCACAGAGGCCCCAGCTACTCCTGA GGTGCTCGGTGGGCCAGAGGGAGTTCCAGAGCCTCTGGTGCAGTGCACAGCCTGGCTGGAAGCCTATTTC CGTGAACCCGCAGCCACAGAGGGGCTTCCCTTGCCTGCTCTCCATCACCCTGTGTTCCAGCAAGATTCAT TCACCAGACAGGTGTTATGGAAGCTGCTGAAGGTTGTGAAATTCGGAGAAACGGTTTCTTACCAGCAATT AGCAGCCCTGGCAGGCAACCCCAAAGCGGCTCGTGCAGTAGGAGGAGCAATGAGAAGCAATCCGGTCCCC ATCCTCATCCCCTGCCACAGGGTGGTTCGCAGTGACGGTGCCATCGGCCATTACTCCGGAGGAGGGCAGG CTGTGAAGGAGTGGCTTCTGGCCCATGAGGGCATCCCGACCGGACAGCCAGCCTCCAAGGGCTTGGGTCT GACTGGGACCTGGCTCAAGTCATCCTTCGAGTCGACCAGCTCTGAGCCGTCTGGCCGAAATTGAGTAACC GTTTGAATGACACATAGATGTAACGCGTGTCGGAAGCGGATGTGTGGTGGCACCACTATATTAAAAGAGC TGCAAGTGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_008598 |
| Insert Size | 636 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC031888, AAH31888 |
| RefSeq Size | 815 bp |
| RefSeq ORF | 636 bp |
| Locus ID | 17314 |
| UniProt ID | P26187 |
| Gene Summary | Involved in the cellular defense against the biological effects of O6-methylguanine (O6-MeG) and O4-methylthymine (O4-MeT) in DNA. Repairs the methylated nucleobase in DNA by stoichiometrically transferring the methyl group to a cysteine residue in the enzyme. This is a suicide reaction: the enzyme is irreversibly inactivated.[UniProtKB/Swiss-Prot Function] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Coordinated Splicing of Regulatory Detained Introns within Oncogenic Transcripts Creates an Exploitable Vulnerability in Malignant Glioma
,Braun, CJ;Stanciu, M;Boutz, PL;Patterson, JC;Calligaris, D;Higuchi, F;Neupane, R;Fenoglio, S;Cahill, DP;Wakimoto, H;Agar, NYR;Yaffe, MB;Sharp, PA;Hemann, MT;Lees, JA;,
Cancer Cell
,PubMed ID 28966034
[MGMT]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG202297 | Mgmt (tGFP-tagged) - Mouse O-6-methylguanine-DNA methyltransferase (Mgmt) |
CNY 4,370.00 |
|
| MR202297 | Mgmt (Myc-DDK-tagged) - Mouse O-6-methylguanine-DNA methyltransferase (Mgmt) |
CNY 3,600.00 |
|
| MR202297L1 | Lenti ORF clone of Mgmt (Myc-DDK-tagged) - Mouse O-6-methylguanine-DNA methyltransferase (Mgmt) |
CNY 5,890.00 |
|
| MR202297L2 | Lenti ORF clone of Mgmt (mGFP-tagged) - Mouse O-6-methylguanine-DNA methyltransferase (Mgmt) |
CNY 6,000.00 |
|
| MR202297L3 | Lenti ORF clone of Mgmt (Myc-DDK-tagged) - Mouse O-6-methylguanine-DNA methyltransferase (Mgmt) |
CNY 6,000.00 |
|
| MR202297L4 | Lenti ORF clone of Mgmt (mGFP-tagged) - Mouse O-6-methylguanine-DNA methyltransferase (Mgmt) |
CNY 5,890.00 |
