United States
Germany
Japan
United Kingdom
China
Mfap5 (NM_015776) Mouse Untagged Clone
CAT＃: MC202187
Mfap5 (untagged) - Mouse microfibrillar associated protein 5 (Mfap5), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | MAGP-2; MFAP-5 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC025131 sequence for NM_015776
ACGGACACACTCAGCAGCCAGAGGCCACCGGCAGACAGATCGCAGCTCTGTAGACAATATGCTGTTCTTG GGGCAGAAGGCCTTGCTGCTTGTCTTGGCAGTCAGCATCCCCTCTGACTGGCTACCCCTAGGGGTCAGTG GTCAACGTGGAGATGATGTGCCTGAGACATTCACAGACGACCCTAATCTGGTGAACGATCCCTCTACAGA CGATACAGCTCTGGCTGATATCACACCTTCCACGGACGACCTAGCTGATGACAAAAATGCTACTGCAGAG TGCCGGGATGAGAAGTTTGCTTGTACAAGACTGTACTCTGTCCATCGGCCAGTCAGACAGTGTGTGCACC AGTCCTGCTTCACCAGTTTACGGCGCATGTACATCATCAATAATGAGATCTGTTCCCGACTCGTCTGTAA AGAACATGAAGCTATGAAAGATGAGCTTTGCCGGCAGATGGCAGGCCTGCCTCCAAGGCGACTCCGGCGC TCCAACTACTTCCGACTTCCTCCCTGTGAAAATATGAATTTGCAGAGACCCGATGGTCTGTGATCACCAA GGAAGAAAGAAGAAAATGTGGATGAAGGAATCGAAAATTCTTTCTCCTTCAACCCCTGCCATCTGTCCCG TAGACATGTATTTTTAAACTAAGCCCTTTGCAATGCCCCGGCTTCCTACCCTACTCTAATTTTCACTGGT GCTGGTAACGTTTGTCTCATTTTGCGGTACTGACAATACATTGTCTATATTGTGAAAAAAAAAAAAAAAA AAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_015776 |
| Insert Size | 495 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC025131, AAH25131 |
| RefSeq Size | 773 bp |
| RefSeq ORF | 495 bp |
| Locus ID | 50530 |
| UniProt ID | Q9QZJ6 |
| Gene Summary | May play a role in hematopoiesis. In the cardiovascular system, could regulate growth factors or participate in cell signaling in maintaining large vessel integrity (PubMed:23963447). Component of the elastin-associated microfibrils (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201311 | Mfap5 (tGFP-tagged) - Mouse microfibrillar associated protein 5 (Mfap5) |
CNY 2,850.00 |
|
| MR201311 | Mfap5 (Myc-DDK-tagged) - Mouse microfibrillar associated protein 5 (Mfap5) |
CNY 1,200.00 |
|
| MR201311L3 | Lenti ORF clone of Mfap5 (Myc-DDK-tagged) - Mouse microfibrillar associated protein 5 (Mfap5) |
CNY 4,750.00 |
|
| MR201311L4 | Lenti ORF clone of Mfap5 (mGFP-tagged) - Mouse microfibrillar associated protein 5 (Mfap5) |
CNY 4,750.00 |
