Hcfc1r1 (NM_181821) Mouse Untagged Clone
CAT#: MC202658
Hcfc1r1 (untagged) - Mouse host cell factor C1 regulator 1 (XPO1-dependent) (Hcfc1r1), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | HPIP |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC079865 sequence for NM_181821
GGACCCTGAGCCGTAATGATCCTGCAACAGCCCCTGGAGCGAGGTCCCCCAAGTCGGGACCCACGGGCCA CCACTGGGGTAACTCGCGGCCTAAACGCCAGTCTTTCCCCCAGGGAACCTTTGCACAAGCAGTTCCTGTC TGAGGAGAACATGGCCACCCATTTCTCCCGACTCAGCCTACATAATGACCACCCCTACTGCAGCCCCCCT GTGACTTTTCCCGAAGCCCTGCCACCACTCAGGAGCCCTTGCCCAGAGCTGCTTCTCTGGCGCTATCCCG GGAGCCTGATTCCTGAAGCCCTCAGGCTGCTGAGGCTGGGGGATACCCCCAGTCCCTACTACCCTGCGTC CCCAGCTGGGGATATCGTGGAGCTCTGAGTATTGATGGCCTGTGTCCCTCCCTATCTTCTTTCTGACAAC AAAGACCAGCAACTCCCAGAAAGGGATGAAGTCCTTCTGCAAACCTGGCCACCAGGACCTTCCCTCTGAC AAGAGGACACTAGCTCGGTGGAACCCTCAGTGAAAGGCAGCCTGGGAAAGGGAAAATGTTACCCCATTAG TGAATAAAGACCTGTGAGCAGTTGAAAAAAAAAAAAAAAAAAA |
Restriction Sites | AscI-NotI |
ACCN | NM_181821 |
Insert Size | 363 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC079865, AAH79865 |
RefSeq Size | 603 bp |
RefSeq ORF | 363 bp |
Locus ID | 353502 |
UniProt ID | Q9CYQ5 |
Gene Summary | Regulates HCFC1 activity by modulating its subcellular localization. Overexpression of HCFC1R1 leads to accumulation of HCFC1 in the cytoplasm. HCFC1R1-mediated export may provide the pool of cytoplasmic HCFC1 required for import of virion-derived VP16 into the nucleus (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200577 | Hcfc1r1 (tGFP-tagged) - Mouse host cell factor C1 regulator 1 (XPO1-dependent) (Hcfc1r1) |
CNY 2,850.00 |
|
MR200577 | Hcfc1r1 (Myc-DDK-tagged) - Mouse host cell factor C1 regulator 1 (XPO1-dependent) (Hcfc1r1) |
CNY 1,200.00 |
|
MR200577L3 | Lenti ORF clone of Hcfc1r1 (Myc-DDK-tagged) - Mouse host cell factor C1 regulator 1 (XPO1-dependent) (Hcfc1r1) |
CNY 4,750.00 |
|
MR200577L4 | Lenti ORF clone of Hcfc1r1 (mGFP-tagged) - Mouse host cell factor C1 regulator 1 (XPO1-dependent) (Hcfc1r1) |
CNY 4,750.00 |
其它Hcfc1r1产品