Pde6g (NM_012065) Mouse Untagged Clone
CAT#: MC202760
Pde6g (untagged) - Mouse phosphodiesterase 6G, cGMP-specific, rod, gamma (Pde6g), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | p3AT; Pdeg |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC082288 sequence for NM_012065
GGCTTCCTGAGATCTGTCCAGTGCTTGCCTGCATGAGGACACCAGCCCAGCCTGACAGAGTCCAGAAGCT AAGGGTCACTGCAGTGTCTCTGCCAGCCTCACCATGAACCTGGAGCCACCCAAGGGTGAGATTCGGTCAG CCACCCGGGTGATAGGAGGACCAGTCACCCCCAGGAAAGGACCACCTAAGTTTAAGCAGCGGCAAACAAG GCAGTTCAAGAGCAAGCCCCCCAAGAAAGGCGTGCAAGGGTTTGGGGATGACATCCCTGGAATGGAAGGC CTGGGGACAGATATCACCGTCATCTGCCCTTGGGAGGCCTTCAATCACCTAGAGCTGCACGAGCTGGCCC AGTATGGCATCATTTAGTCAGATCCCTGCTATGTGAGCCCTGGGGAAGAAACCTGCTGAAGACTCCCTCC CCCCTCTGCAAACCCTGTCCAGGACCCAAACCTGAGCCTGAGTCCCTAGCCAGGTTACCATGGCCTCCCC CGGGACAATCTCAGGCCCTGACACCAGCTACTGAGAGCCTACAGCCTCCCACAGGATACCCTGTTGACCT GAAGTCACTGGTCAGCAGAAAGAAGGGAGTGGGACCCAGCCCCACTTCCTGTCCTTTTTGTGGCTGTAAT GCAGGGCTCCCCTTTGTTCCCCTGAACTGCCTTCTGAGGGTGAGAAAGTTCCTCTGTCTTGTAGCCCTTC CAGATGGGTGTCTTGGGGTGGGACACTGTCCTGGGGTGAGGTGGCAAGAGAGACTAAGCTACTCCATCCG TTATAACAACCTTCCCAACATACTCTTGTCCCTTGTCCCTATTTCAAAATAAAGTCAGCATGTCCTTGCA AAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_012065 |
Insert Size | 264 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC082288, AAH82288 |
RefSeq Size | 854 bp |
RefSeq ORF | 264 bp |
Locus ID | 18588 |
UniProt ID | P09174 |
Gene Summary | Participates in processes of transmission and amplification of the visual signal. cGMP-PDEs are the effector molecules in G-protein-mediated phototransduction in vertebrate rods and cones.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the functional protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200198 | Pde6g (tGFP-tagged) - Mouse phosphodiesterase 6G, cGMP-specific, rod, gamma (Pde6g) |
CNY 2,850.00 |
|
MR200198 | Pde6g (Myc-DDK-tagged) - Mouse phosphodiesterase 6G, cGMP-specific, rod, gamma (Pde6g) |
CNY 1,200.00 |
|
MR200198L3 | Lenti ORF clone of Pde6g (Myc-DDK-tagged) - Mouse phosphodiesterase 6G, cGMP-specific, rod, gamma (Pde6g) |
CNY 4,750.00 |
|
MR200198L4 | Lenti ORF clone of Pde6g (mGFP-tagged) - Mouse phosphodiesterase 6G, cGMP-specific, rod, gamma (Pde6g) |
CNY 4,750.00 |