Rps27 (NM_027015) Mouse Untagged Clone
CAT#: MC202796
Rps27 (untagged) - Mouse ribosomal protein S27 (Rps27), transcript variant 1, (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 3200001M24Rik |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC055693 sequence for NM_027015
GGTGACGACCTCCCTACGAGAACATGCCTCTCGCAAAGGATCTCCTTCATCCCTCTCCAGAAGAGGAGAA GAGGAAACACAAGAAAAAGCGCCTGGTGCAGAGCCCCAATTCCTACTTTATGGACGTGAAATGCCCAGGA TGCTATAAAATCACCACGGTCTTTAGCCATGCACAAACGGTAGTCTTGTGTGTTGGCTGCTCCACTGTCC TCTGTCAGCCTACAGGTGGAAAAGCAAGGCTGACAGAAGGATGCTCCTTCAGGAGGAAGCAGCACTGAAA GCCCCTGATTGAAGATGAGTGGGAACCTTCCCAATAAACACGTTTTGGATATATAAAAAAAAAAAAAAAA AAAAAAAAAA |
Restriction Sites | AscI-NotI |
ACCN | NM_027015 |
Insert Size | 255 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC055693, AAH55693 |
RefSeq Size | 360 bp |
RefSeq ORF | 255 bp |
Locus ID | 57294 |
UniProt ID | Q6ZWU9 |
Gene Summary | Component of the small ribosomal subunit (By similarity). Required for proper rRNA processing and maturation of 18S rRNAs (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the functional protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200174 | Rps27 (tGFP-tagged) - Mouse ribosomal protein S27 (Rps27) |
CNY 2,850.00 |
|
MG221721 | Rps27 (tGFP-tagged) - Mouse ribosomal protein S27 (Rps27) transcript variant 1, (10ug) |
CNY 2,850.00 |
|
MR221721 | Rps27 (Myc-DDK-tagged) - Mouse ribosomal protein S27 (Rps27), transcript variant 1 |
CNY 1,200.00 |
|
MR221721L3 | Lenti ORF clone of Rps27 (Myc-DDK-tagged) - Mouse ribosomal protein S27 (Rps27), transcript variant 1 |
CNY 4,750.00 |
|
MR221721L4 | Lenti ORF clone of Rps27 (mGFP-tagged) - Mouse ribosomal protein S27 (Rps27), transcript variant 1 |
CNY 4,750.00 |