United States
Germany
Japan
United Kingdom
China
Apoc1 (NM_007469) Mouse Untagged Clone
CAT＃: MC202950
Apoc1 (untagged) - Mouse apolipoprotein C-I (Apoc1), transcript variant 1, (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | apo-CI; Apo-CIB; apoC-I; ApoC-IB |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC019398 sequence for NM_007469
CCCTCCTGAGAGATCCTTAGATCCAGGGTGCCCCTCCAACCAGGATGAGGCTCTTCATCGCTCTTCCTGT CCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGA ACATTGGAGAGCATACCGGATAAACTGAAGGAGTTTGGGAACACTTTGGAAGACAAGGCCCGGGCAGCCA TTGAACATATCAAACAGAAGGAAATTTTGACCAAGACCCGGGCCTGGTTCTCAGAGGCATTTGGCAAAGT GAAGGAGAAGTTGAAGACCACGTTCTCCTGAGCACCTGGCGGGCCACCTCGAAGCATCAAGGACATCCAC GTAATGTGCCAGGTCCCTCTTCATCACAGACCAATAAAAAACGTGTAGAAGGCAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_007469 |
| Insert Size | 267 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | BC019398, AAH19398 |
| RefSeq Size | 420 bp |
| RefSeq ORF | 267 bp |
| Locus ID | 11812 |
| UniProt ID | P34928 |
| Gene Summary | This gene encodes a precursor plasma protein that is cleaved to yield a signal peptide and two alternatively processed mature peptides. The encoded protein, which is a component of chylomicrons, very low density lipoproteins and high density lipoproteins, transports lipids from the intestines to other locations in the body. This protein binds to free fatty acids preventing their uptake by cells. This protein is a cofactor for lecithin cholesterol acyltransferase, an enzyme that catalyzes the conversion of free cholesterol to cholesteryl esters. The encoded protein inhibits the activity of the cholesteryl ester transfer protein which promotes the exchange of neutral lipids between lipoproteins. In humans this gene is associated with risk of coronary artery disease and age-associated memory impairment. Mice lacking this gene demonstrate impaired memory. This gene is clustered with three other apolipoprotein genes on chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013] Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200207 | Apoc1 (tGFP-tagged) - Mouse apolipoprotein C-I (Apoc1) |
CNY 2,850.00 |
|
| MG220182 | Apoc1 (tGFP-tagged) - Mouse apolipoprotein C-I (Apoc1) transcript variant 1, (10ug) |
CNY 2,850.00 |
|
| MR220182 | Apoc1 (Myc-DDK-tagged) - Mouse apolipoprotein C-I (Apoc1), transcript variant 1 |
CNY 1,200.00 |
|
| MR220182L3 | Lenti ORF clone of Apoc1 (Myc-DDK-tagged) - Mouse apolipoprotein C-I (Apoc1), transcript variant 1 |
CNY 4,750.00 |
|
| MR220182L4 | Lenti ORF clone of Apoc1 (mGFP-tagged) - Mouse apolipoprotein C-I (Apoc1), transcript variant 1 |
CNY 4,750.00 |
