Tomm22 (NM_172609) Mouse Untagged Clone

CAT#: MC203396

Tomm22 (untagged) - Mouse translocase of outer mitochondrial membrane 22 homolog (yeast) (Tomm22), nuclear gene encoding mitochondrial protein, (10ug)



  "NM_172609" in other vectors (4)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2310047D01; Tom22
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC056920
ACAGCCATGGCCGCCGCCGTCGCTGCAGCCGGCGCTGGGGAGCCTCTGTCCCCCGAGGAATTACTCCCGA AAGCCGAGGCAGAGAAAGCCGAGGAGGAGCTGGAAGAAGACGACGACGACGAGCTAGACGAGACCCTGTC GGAGAGACTCTGGGGTCTGACGGAGATGTTTCCCGAGAGGGTCCGGTCAGCCGCCGGAGCCACCTTTGAC CTCTCGCTCTTCGTGGCTCAGAAGATGTACAGATTTTCCAGGGCAGCTTTGTGGATTGGGACCACTTCCT TCATGATCCTGGTTCTTCCCGTTGTCTTTGAGACAGAAAAGTTGCAGATGGAGCAACAGCAGCAACTGCA GCAACGGCAGATACTTTTAGGGCCTAACACAGGGCTGTCAGGAGGAATGCCAGGGGCTCTACCTCCACTT CCTGGAAAGATGTAGATTCTTCCTTCGGTATTTGTCCTTGTGGGAGAACTTTGAAATTCATTTGTGTTTG AACTGCTGATTGTTGGAACTTTTTATTCTTTTTTTTAACCTTGGCACATGGATCTATTTGAACATAGTGG GAACTTTCTCTGTTTCTCATGGAGAGACCCCAGGTACACCTGTGCCCTACATAATGAAGTCCCTCACTTA CTTCTTCCTGTTCTCACTCCAATGCTGGAGTACAGCCATGTGGAAGGTTAGCCTACTCTCTAATAAACTG CTCCTAAGGAAGTTCTTACATGCCCATTGTGGGAAAGAAGTAAGTACCCCTGACCATAAGGACTTTTTTT TAATGGAAATGTCTAGGACATGTAAGCACCGTGGCACTGACAAAATTCATTATACCTGAGTACAGAAGTC ACCAGGAATCCCAGAGAGAAGGGAGGCTGGCTGTAGCTTTAGCCAGAGGGGGACTGGGCAGAGCAGGCAC TCATTTCCTCTGCAGAGTTTGGCTCTTAGACCTGCTTATGTATAAAAAAGAAGTCAGCGCTCACTTTTTG TATTTAAATATTAAAAGAACTCGAACTGAAAAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
ACCN NM_172609
Insert Size 429 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC056920, AAH56920
RefSeq Size 1029 bp
RefSeq ORF 429 bp
Locus ID 223696
UniProt ID Q9CPQ3
Gene Summary Central receptor component of the translocase of the outer membrane of mitochondria (TOM complex) responsible for the recognition and translocation of cytosolically synthesized mitochondrial preproteins. Together with the peripheral receptor TOM20 functions as the transit peptide receptor and facilitates the movement of preproteins into the translocation pore (By similarity). Required for the translocation across the mitochondrial outer membrane of cytochrome P450 monooxygenases (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...