Rhod (NM_007485) Mouse Untagged Clone

CAT#: MC203609

Rhod (untagged) - Mouse ras homolog gene family, member D (Rhod), (10ug)



  "NM_007485" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI326383; Arhd; Rho; RhoHP1; RhoM
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC047989
CGCCGGGCCAGCCCCGCGCCCGCCGCAGCCAGCCCGCCGCGTACCGCCTGCTGCTCCGCGCACCGCCGTC CGCCAGCCAGGGATGAACGCGTCCCAGGTTGCGGGAGAAGAGGCGCCGCAGAGCGGGCACTCGGTCAAGG TGGTCCTGGTGGGCGACGGGGGCTGCGGGAAGACGTCACTGATGATGGTCTTCGCCAAAGGGGCCTTCCC AGAGAGCTACAGTCCCACAGTGTTTGAGCGCTATAATGCCACTCTGCAGATGAAGGGTAAACCTGTGCAC CTCCAAATCTGGGACACAGCCGGGCAAGATGACTATGACCGCCTCCGGCCCTTGTTCTATCCTGATGCCA ATGTCTTGCTCCTCTGCTTCGATGTGACCAATCCAAACAGCTTTGACAACGTCTCCAACCGGTGGTACCC AGAGGTGACACATTTCTGCAAGGGAGTGCCCATCATTGTTGTGGGCTGCAAGATAGACCTGCGTAAGGAC AAGGTGCTGGTGAACAACCTGCGGAAGAAAAGACTGGAGCCCGTGACCTACCACAGGGGCCACGATATGG CAAGGTCTGTGGGAGCGGTGGCCTATCTTGAGTGTTCAGCTCGGCTCCATGACAACGTGGAAGCCGTCTT CCAGGAAGCAGCAGAAGTGGCTCTCAGCAGTCGCAGACATAACTTTTGGCGGCGGATTACTCAGAATTGT TGCTTGGCCACCTGACTGGCTTGGAACCCACCTTGCCTTCCGGTTTACTCCGCTGCAGAAAGACCCAGAA GCAGAACTTGTACTCTGTTGACTGGGATGGACCTAATCCCTAGGCTGAGCTGGTAGAACCACACATCCAT CCACAGATGGGCTCCAATGAGGCCTGGCCCCTGGACCGAGGAATCCTGGATTGAGGAAGAGGGTTCCCAG ACCCTTAGCTCTGGAACCATTATAGACTCCTGTGCCCAATCCTGGACCTGCGTCCTGAGCGGGGTCTGTG CGGTCTGTTTGGCGCCACCTTGTGGCTATTCTATTGAGTTATATCTACAGGACCTAGGGTTCCCAAGACC ATCTTGCCCGGGCTAATACCCTGCCCCGTCCGTGATCATCCTATTTATCCCATTGCTAAGTGTAACAACT AAAATGGCAGCACTTGCAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_007485
Insert Size 633 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC047989, AAH47989
RefSeq Size 1153 bp
RefSeq ORF 633 bp
Locus ID 11854
UniProt ID P97348
Gene Summary Involved in endosome dynamics. May coordinate membrane transport with the function of the cytoskeleton. Involved in the internalization and trafficking of activated tyrosine kinase receptors such as PDGFRB. Participates in the reorganization of actin cytoskeleton; the function seems to involve WHAMM and includes regulation of filopodia formation and actin filament bundling. Can modulate the effect of DAPK3 in reorganization of actin cytoskeleton and focal adhesion dissolution.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...