Prdx6 (NM_007453) Mouse Untagged Clone

CAT#: MC203805

Prdx6 (untagged) - Mouse peroxiredoxin 6 (Prdx6), (10ug)



  "NM_007453" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1-cys; 1-Cys Prx; 1-cysPrx; 9430088D19Rik; a; AA690119; aiPLA2; Aop2; Brp-; Brp-12; CP-; CP-3; GP; GPx; LPCAT-5; Ltw; Ltw-; Ltw-4; Ltw4; Lvtw; Lvtw-4; N; NSGPx; ORF06; Prdx5
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC013489
CACTGCCGCCATGCCCGGAGGGTTGCTTCTCGGGGACGAAGCCCCCAACTTTGAGGCCAATACCACCATC GGCCGCATCCGCTTCCACGATTTCCTGGGAGATTCATGGGGCATTCTCTTTTCCCACCCACGGGACTTTA CCCCAGTGTGCACCACAGAACTTGGCAGAGCTGCAAAGCTGGCGCCAGAGTTTGCCAAGAGGAATGTTAA GTTGATTGCTCTTTCAATAGACAGTGTTGAGGATCATCTTGCCTGGAGCAAGGACATCAATGCTTACAAT GGTGAAACACCCACGGAAAAGTTGCCATTTCCCATCATTGATGATAAGGGCAGGGACCTTGCCATCCTTT TGGGCATGTTGGATCCAGTCGAGAAGGACGCTAACAACATGCCTGTGACGGCCCGTGTGGTGTTCATTTT TGGCCCTGACAAGAAACTGAAGCTGTCTATCCTCTACCCTGCCACCACGGGCAGGAACTTTGATGAGATT CTCAGAGTGGTTGACTCTCTCCAGCTGACAGGCACAAAGCCGGTTGCCACCCCAGTTGACTGGAAGAAGG GAGAGAGCGTGATGGTAGTTCCCACCCTCTCCGAAGAGGAAGCCAAACAATGTTTCCCTAAAGGAGTCTT CACCAAAGAGCTCCCGTCTGGCAAAAAATACCTCCGTTATACACCCCAGCCTTAAGTCTTTGCGGAAATT GGGGCTGCATCTGCACATCCAGTACTGGGGCCTGAGGATGTCAGCTGGCAGCCGTGGGTCCTTGCAGCAG GTCCGTAGAAAGATCGTGGCATGATCACAGCCGGTCCTGTAGATCGCTCGCTATACTACTGGGTCATTAA ATGGAAATGGCACCAAAACCTTCTCGGGATTCTTTACTCTGTGCCTTCGCCAGCATTCTGCCCCTCTGCC TGTCACAGTGCCCTACTGACTGGCTCTCTTTGAAACGAATTATGTATTGAAGATTCCTTAGGTCTCTGTA GGGTCTTTGATCAGCAAACAAGGTAGTGTCAGTGTGGGCTCTGTGCTAGAATGATGAAACACCTTTTGTA TCTTTCCGAACTGAATCTTCTGTTACCCATTTTGGAGAGCACTGACATAGGGAGAAGCTTTCGATTCTGT ATTTTTAGTAAATAAAAAGTGGGGACAGCCGGGAGAATTCTTACAGGGAATCTATTGTAAGTTTCTATCG AAGTGGGCTCAGAAAGCCTTTCGCCTCCCAAGAGTGCGCATGTACCTCCTAGAGTTTCCACATCTGCTCT CTGGTGATGTCTGCCTGTGAACGCACCTTATAAAAGACGGGCGGTGACAGTGTTTTACCACTCAGTGTCC TAGTAGTGGGTGGCCATTTCTGAATTCTGCTTTTTGAGGTTCAACAAATAAAATCCTGATCAGAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_007453
Insert Size 675 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC013489, AAH13489
RefSeq Size 1440 bp
RefSeq ORF 675 bp
Locus ID 11758
UniProt ID O08709
Gene Summary This gene encodes a member of the peroxiredoxin family of peroxidases. The encoded protein is a bifunctional enzyme that has glutathione peroxidase and phospholipase activities. This protein is an antioxidant that reduces peroxidized membrane phospholipids and plays an important role in phospholipid homeostasis based on its ability to generate lysophospholipid substrate for the remodeling pathway of phospholipid synthesis. Mice lacking this gene are sensitive to oxidant stress, have altered lung phospholipid metabolism and susceptible to skin tumorigenesis. Alternate splicing of this gene results in multiple transcript variants. A pseudogene of this gene is found on chromosome 4. [provided by RefSeq, Dec 2014]
Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...