Timm17a (NM_011590) Mouse Untagged Clone
CAT#: MC203812
Timm17a (untagged) - Mouse translocase of inner mitochondrial membrane 17a (Timm17a), nuclear gene encoding mitochondrial protein, (10ug)
CNY 2,400.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 17kDa; mTim17a |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC010830
GCCAAGATGGAGGAATACGCGAGAGAGCCGTGCCCCTGGCGAATTGTAGATGACTGTGGCGGTGCATTTA CCATGGGCACCATAGGTGGTGGCATCTTCCAGGCCTTCAAAGGTTTTCGAAATTCTCCAGTGGGAATAAA CCACAGACTCCGAGGAAGTTTGACAGCTATTAAAACCAGGGCTCCACAGTTGGGAGGTAGCTTTGCAGTT TGGGGAGGACTGTTTTCCACGATTGACTGCAGTATGGTTCAAATACGAGGCAAAGAAGACCCCTGGAACT CCATCACTAGCGGTGCCTTAACAGGAGCCATCCTGGCAGCAAGAAATGGACCGGTAGCCATGGTTGGGTC CGCTGCGATGGGCGGCATTCTCCTAGCTTTAATTGAAGGAGCTGGTATCTTGCTGACAAGATTTGCCTCT GCACAGTTTCCCAATGGCCCTCAGTTCACTGAAGATCACTCCCAGTTGCCTTCCAGCCAGTTGCCATCCT CGCCGTTTGGAGACTACCGACAGTATCAGTAGGACTTGGTTCCCAGGATTCCTGGAACCGGGTGGACTGT AGTTCGGTAGGATTTCAGAAGATCAAGTTACAGTCTGTTTAAAGCCTTAGGTGGGACATCAGCGGCCAAG CGGGCCATAAAGAGACATTTAGCACATTTTTCTATTTAAAAGAGACTCAGAGGGTGAAAAATATACTGAG TTTATTTATTCTTGCTTGGATTGCATCTGTGATCAAAATAAATGTCTAATACCATTTAAAGAATGTATAT GAGCTTAGAAGATAAAGGACCAAAGGCCAAATAACAGTGACACTCCACCATCATTCCTTCGGGACTTCTC TGCCTGGTGTTTTGTGTACAGTTATTCAGACAATAAAAGGCTTCTGGGACTTAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_011590 |
Insert Size | 516 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC010830, AAH10830 |
RefSeq Size | 924 bp |
RefSeq ORF | 516 bp |
Locus ID | 21854 |
UniProt ID | Q9Z0V8 |
Gene Summary | Essential component of the TIM23 complex, a complex that mediates the translocation of transit peptide-containing proteins across the mitochondrial inner membrane.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201445 | Timm17a (tGFP-tagged) - Mouse translocase of inner mitochondrial membrane 17a (Timm17a) |
CNY 4,000.00 |
|
MR201445 | Timm17a (Myc-DDK-tagged) - Mouse translocase of inner mitochondrial membrane 17a (Timm17a), nuclear gene encoding mitochondrial protein |
CNY 2,400.00 |
|
MR201445L3 | Lenti ORF clone of Timm17a (Myc-DDK-tagged) - Mouse translocase of inner mitochondrial membrane 17a (Timm17a), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |
|
MR201445L4 | Lenti ORF clone of Timm17a (mGFP-tagged) - Mouse translocase of inner mitochondrial membrane 17a (Timm17a), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |
其它Timm17a产品