United States
Germany
Japan
United Kingdom
China
Cryab (NM_009964) Mouse Untagged Clone
CAT＃: MC203828
Cryab (untagged) - Mouse crystallin, alpha B (Cryab), (10ug)
CNY 2,400.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Cry; Crya; Crya-2; Crya2; Hsp; HspB5; P23 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC010768
GAAACAAGACCATGACAAGTCACCGGTCAGCTCAGCCCTGCCTGTGTTTCTCTTTTCTTAGCTCAGTGAG TACCGGAAGCTTCAGAAGACTGCATATATAAGGGGCCGGCTGGAGCTGCTGCTGAAGGAGTTGACCAGCC AACCGACTCTGCATTCATCTAGCCACAATGGACATCGCCATCCACCACCCCTGGATCCGGCGCCCCTTCT TCCCCTTCCACTCCCCAAGCCGCCTCTTCGACCAGTTCTTCGGAGAGCACCTGTTGGAGTCTGACCTCTT CTCAACAGCCACTTCCCTGAGCCCCTTCTACCTTCGGCCACCCTCCTTCCTGCGGGCACCCAGCTGGATT GACACCGGACTCTCAGAGATGCGTTTGGAGAAGGACAGATTCTCTGTGAATCTGGACGTGAAGCACTTCT CTCCGGAGGAACTCAAAGTCAAGGTTCTGGGGGACGTGATTGAGGTCCACGGCAAGCACGAAGAACGCCA GGACGAACATGGCTTCATCTCCAGGGAGTTCCACAGGAAGTACCGGATCCCAGCCGATGTGGATCCTCTC ACCATCACTTCATCCCTGTCATCTGATGGAGTCCTCACTGTGAATGGACCAAGGAAACAGGTGTCTGGCC CTGAGCGCACCATTCCCATCACCCGTGAAGAGAAGCCTGCTGTCGCCGCAGCCCCTAAGAAGTAGATCCC CTTTCCTCATTGAGTTTTTTTTAAAACAAGGAAGTTTCCCATCAGTGATTGAAAATCTGTGACTAGTGCT GAAGCTTATTAATGCTAAGGGCTGGCCCAGATTATTAAGCTAATAAAAATATCATTCAGCAACAAAAAAA AAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_009964 |
| Insert Size | 528 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC010768, AAH10768 |
| RefSeq Size | 848 bp |
| RefSeq ORF | 528 bp |
| Locus ID | 12955 |
| UniProt ID | P23927 |
| Gene Summary | This gene encodes a member of the small heat-shock protein (HSP20) family. The encoded protein is a molecular chaperone that protects proteins against thermal denaturation and other stresses. This protein is a component of the eye lens, regulates lens differentiation and functions as a refractive element in the lens. This protein is a negative regulator of inflammation, has anti-apoptotic properties and also plays a role in the formation of muscular tissue. Mice lacking this gene exhibit worse experimental autoimmune encephalomyelitis and inflammation of the central nervous system compared to the wild type. In mouse models, this gene has a critical role in alleviating the pathology of the neurodegenerative Alexander disease. Mutations in the human gene are associated with myofibrillar myopathy 2, fatal infantile hypertonic myofibrillar myopathy, multiple types of cataract and dilated cardiomyopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 through 4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Binding of a glaucoma-associated myocilin variant to the αB-crystallin chaperone impedes protein clearance in trabecular meshwork cells
,Lynch, JM;Li, B;Katoli, P;Xiang, C;Leehy, B;Rangaswamy, N;Saenz-Vash, V;Wang, YK;Lei, H;Nicholson, TB;Meredith, E;Rice, D;Prasanna, G;Chen, A;,
J. Biol. Chem.
,PubMed ID 30389787
[CRYAB]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201515 | Cryab (tGFP-tagged) - Mouse crystallin, alpha B (Cryab) |
CNY 2,850.00 |
|
| MR201515 | Cryab (Myc-DDK-tagged) - Mouse crystallin, alpha B (Cryab) |
CNY 2,400.00 |
|
| MR201515L1 | Lenti ORF clone of Cryab (Myc-DDK-tagged) - Mouse crystallin, alpha B (Cryab) |
CNY 4,750.00 |
|
| MR201515L2 | Lenti ORF clone of Cryab (mGFP-tagged) - Mouse crystallin, alpha B (Cryab) |
CNY 4,750.00 |
|
| MR201515L3 | Lenti ORF clone of Cryab (Myc-DDK-tagged) - Mouse crystallin, alpha B (Cryab) |
CNY 4,750.00 |
|
| MR201515L4 | Lenti ORF clone of Cryab (mGFP-tagged) - Mouse crystallin, alpha B (Cryab) |
CNY 4,750.00 |
