Med30 (NM_027212) Mouse Untagged Clone
CAT#: MC203916
Med30 (untagged) - Mouse mediator complex subunit 30 (Med30), (10ug)
CNY 2,400.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1810038N03Rik; 2510044J04Rik; Thrap6; TRAP25 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC020113
TTTTGAAATCGGCCGAGTGGGCTCGCGCCGGACCCGAGCCGCCGGGGGGTGCCATGTCCACCCCTCCGCT GGCGCCCACGGGCATGGCGTCCGGGCCCTTCGGCGGCCCGCAGGCTCAGCAGGCCGCGCGCGAGGTCAAC ACGGCCACGCTGTGCCGCATCGGGCAGGAGACCGTGCAGGACATCGTGTACCGCACCATGGAGATCTTCC AGCTGCTCAGGAACATGCAGCTGCCAAATGGTGTCACTTACCATACTGGAACTTACCAAGACCGGCTAAC AAAGCTGCAGGACCACCTTCGGCAACTTTCTATTCTCTTCAGGAAGCTGCGACTGGTCTATGACAAATGT AATGAGAACTGTGGTGGGATGGACCCCATTCCTGTTGAGCAACTGATTCCATATGTGGATGAAGATGGCT CAAAGAACGACGACCGGGCTGGTCCACCTCGTTTTGCTAGCGAAGAGAGACGAGAAATTGTAGAAGTAAA TAAGAAACTCAAACAGAAGAATCAACAGCTGAAGCAGATTATGGATCAATTACGGAATCTCATCTGGGAC ATAAATGCCATGCTAGCAATGAGGAACTAAAGCGATATTTAAATCTCCTGCTCTACTCATGTGATGCAGT TGGGTTTTTCCCCTCTCTTGAGTATTCCTCCCTTTGAAAAACATTATTTATGTCTTTATTTTAACAGCTA GCACTAAAGTTTCTGTTTTCACTTTAAAGTATTTACTAGCTTTTTTTTTAATACTGTGGGTTTTATGAAA GATTATTGTAATACCTTTGATAGGGTATAAATTTTGGTTAATCTTCAGAAATTGAATAAATTAAAAAAAT ACAAATAAAAATTTAAACATTAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_027212 |
Insert Size | 537 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC020113, AAH20113 |
RefSeq Size | 876 bp |
RefSeq ORF | 537 bp |
Locus ID | 69790 |
UniProt ID | Q9CQI9 |
Gene Summary | Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201574 | Med30 (tGFP-tagged) - Mouse thyroid hormone receptor associated protein 6 (Thrap6) |
CNY 2,850.00 |
|
MR201574 | Med30 (Myc-DDK-tagged) - Mouse mediator complex subunit 30 (Med30) |
CNY 2,400.00 |
|
MR201574L3 | Lenti ORF clone of Med30 (Myc-DDK-tagged) - Mouse mediator complex subunit 30 (Med30) |
CNY 4,750.00 |
|
MR201574L4 | Lenti ORF clone of Med30 (mGFP-tagged) - Mouse mediator complex subunit 30 (Med30) |
CNY 4,750.00 |