Ffar2 (NM_146187) Mouse Untagged Clone

CAT#: MC203984

Ffar2 (untagged) - Mouse free fatty acid receptor 2 (Ffar2), transcript variant 1, (10ug)



  "NM_146187" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms GPCR43; Gpr43
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC019570
ATCCCGCCCAAGGCTAAGTCAATAATTGCTCTGGGCAGTTCTGGCAGGTGGCTTGAGCAAGCGGTGGTGA AGAGCAGACAGCTTTGGACTGAGGACAGGAGAGAACCAGAGAGGATGTGAGCAGTCAGAACTCTCCGGAA AGAGGGTCTGCAGGCTGTGTGCACTGCAGGTGGGGAGCTCTTGACCCTACACCTTTCCCCCCATCTTCCA GAATGACCCCAGACTGGCACAGTTCCTTGATCCTCACGGCCTACATCCTCATCTTTCTTACTGGGCTCCC TGCCAACCTGCTGGCCCTGCGGGCCTTCATGGGCCGGGTTCGCCAGCCTCAGCCTGCCCCTGTGCACATC CTCCTGCTTAATCTGACCCTGGCGGACTTGCTCCTGTTGCTGCTGCTGCCCTTCCGGATCGTGGAAGCAG CATCCAACTTCCGCTGGTACCTACCAAAGATCGTGTGCGCGCTGACAGGCTTCGGCTTCTACAGCAGCAT CTACTGCAGCACGTGGCTGCTGGCGGGCATCAGCATGGAACGCTACCTGGGAGTGGCCTTCCCGGTGCAG TACAAGTTATCCCGCCGGCCACTGTATGGAGTGATCGCTGCTCTGGTGGCCTGGATCATGTCCTTTGGCC ACTGCACCATCGTCATCATCGTTCAGTACCTGAACTCAACTGAGCAGGTGGGCACTGAGAACCAAATAAC CTGCTACGAGAACTTCACCCAAGAGCAGCTGGATGTGGTACTGCCCGTACGACTGGAGCTGTGCCTGGTC CTGTTTTTCGTTCCCATGGCAGTCACCATCTTCTGTTATTGGCGCTTCGTGTGGATCATGCTCACGCAGC CCCACGTTGGGGCTCAGAGGCGACGCCGGGCAGTGGGCCTGGCTGTTGTGACGCTTCTTAATTTCCTGGT GTGCTTTGGACCCTACAACATGTCCCACCTGGTGGGGTTCTACCTGAGGCAGAGCCCCTCGTGGCGGGTG GAGGCTGTGGTGTTCAGTTCCCTCAATGCCAGCCTGGATCCATTATTGTTCTACTTCTCCTCCTCCGTGG TGCGCAGAGCTTTTGGGAAAGGTTTGCTACTGATCCGCAATCCTGCCTCCTCTATGCTGGGCAGGGGAGC CAAAGAGACAGTGGAGGGGACCAAGATGGACAGGGGTGGAAGTCAAGCAGAAGGGGTACAGAGTTCTGAA TTTGTCACCGAGTAGAGAGTCCCCCGGATCTTCCCGAGCATTTGGGTCACCCAGAAGTTGGTCTGGTTAG CAGAGCTCCTGAGACTTGGTAAAAGATAAAAGATTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_146187
Insert Size 993 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC019570, AAH19570
RefSeq Size 1354 bp
RefSeq ORF 993 bp
Locus ID 233079
UniProt ID Q8VCK6
Gene Summary G protein-coupled receptor that is activated by a major product of dietary fiber digestion, the short chain fatty acids (SCFAs), and that plays a role in the regulation of whole-body energy homeostasis and in intestinal immunity. In omnivorous mammals, the short chain fatty acids acetate, propionate and butyrate are produced primarily by the gut microbiome that metabolizes dietary fibers. SCFAs serve as a source of energy but also act as signaling molecules. That G protein-coupled receptor is probably coupled to the pertussis toxin-sensitive, G(i/o)-alpha family of G proteins but also to the Gq family (PubMed:23589301). Its activation results in the formation of inositol 1,4,5-trisphosphate, the mobilization of intracellular calcium, the phosphorylation of the MAPK3/ERK1 and MAPK1/ERK2 kinases and the inhibition of intracellular cAMP accumulation. May play a role in glucose homeostasis by regulating the secretion of GLP-1, in response to short-chain fatty acids accumulating in the intestine (PubMed:22190648, PubMed:23589301). May also regulate the production of LEP/Leptin, a hormone acting on the central nervous system to inhibit food intake (PubMed:20399779). Finally, may also regulate whole-body energy homeostasis through adipogenesis regulating both differentiation and lipid storage of adipocytes (PubMed:16123168, PubMed:23589301). In parallel to its role in energy homeostasis, may also mediate the activation of the inflammatory and immune responses by SCFA in the intestine, regulating the rapid production of chemokines and cytokines (PubMed:23665276). May also play a role in the resolution of the inflammatory response and control chemotaxis in neutrophils (PubMed:19917676, PubMed:19865172). In addition to SCFAs, may also be activated by the extracellular lectin FCN1 in a process leading to activation of monocytes and inducing the secretion of interleukin-8/IL-8 in response to the presence of microbes.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript. All five variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...