Magohb (NM_025564) Mouse Untagged Clone
CAT#: MC204689
Magohb (untagged) - Mouse mago-nashi homolog B (Drosophila) (Magohb), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2010012C16Rik; Mago; Magoh; Magoh-rs1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC027505
GCGCCGGCGGCACGTTGGCCCCGCGGTATAGCGGGCTTTACCGAGGGTAAAAATGTCTATGGGTAGTGAT TTCTACCTTCGCTACTACGTCGGGCATAAGGGCAAGTTTGGGCACGAGTTTTTGGAGTTCGAGTTTCGGC CGGACGGGAAGCTTAGATATGCCAACAACAGTAATTATAAAAATGACGTGATGATCAGAAAAGAGGCCTA TGTCCACAAGAGTGTAATGGAAGAACTGAAGAGAATTATTGACGACAGTGAAATTACAAAAGAGGACGAC GCTCTGTGGCCACCCCCTGACAGGGTTGGGCGGCAGGAACTTGAAATCGTAATTGGGGATGAACACATTT CTTTTACCACGTCAAAAATAGGTTCTCTTATTGATGTAAATCAGTCAAAGGATCCTGAAGGCCTTCGTGT ATTTTACTATTTGGTACAAGACTTGAAATGCTTAGTGTTCAGCCTCATTGGTCTACACTTCAAGATTAAG CCAATTTGAATGGGATGTTTTTGAGATTATTTATATATTTAATTAAAGGAAGGGTTTTCTATTGGCAATT TTGGGATTTTTATGAATGTGAAACTTTTATATATAAACTCAATATATGAAAAAAAAAAAAAAAAAAAAAA AA |
Restriction Sites | EcoRI-NotI |
ACCN | NM_025564 |
Insert Size | 441 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC027505, AAH27505 |
RefSeq Size | 632 bp |
RefSeq ORF | 441 bp |
Locus ID | 66441 |
UniProt ID | Q9CQL1 |
Gene Summary | Required for pre-mRNA splicing as component of the spliceosome. Plays a redundant role with MAGOH in the exon junction complex and in the nonsense-mediated decay (NMD) pathway.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer isoform (1). CCDS Note: The coding region has been updated to extend the N-terminus to one that is also supported by available conservation data. The use of an alternative upstream start codon would result in a protein that is 2 aa longer. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200983 | Magohb (tGFP-tagged) - Mouse RIKEN cDNA 2010012C16 gene (2010012C16Rik) |
CNY 2,850.00 |
|
MR200983 | Magohb (Myc-DDK-tagged) - Mouse mago-nashi homolog B (Drosophila) (Magohb) |
CNY 1,200.00 |
|
MR200983L3 | Lenti ORF clone of Magohb (Myc-DDK-tagged) - Mouse mago-nashi homolog B (Drosophila) (Magohb) |
CNY 4,750.00 |
|
MR200983L4 | Lenti ORF clone of Magohb (mGFP-tagged) - Mouse mago-nashi homolog B (Drosophila) (Magohb) |
CNY 4,750.00 |