Pdlim4 (NM_019417) Mouse Untagged Clone
CAT#: MC204696
Pdlim4 (untagged) - Mouse PDZ and LIM domain 4 (Pdlim4), (10ug)
CNY 2,400.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Ril |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC030068
AGCTCCGGCCCGCGATGACCCACTCGGTGACCCTGCGCGGCCCTTCACCCTGGGGCTTCCGCCTGGTGGG CGGCCGGGACTTCAGTGCTCCCCTCACCATCTCGCGGGTTCATGCTGGGAGCAAAGCGGCCCTGGCTGCC CTGTGCCCAGGTGACTTGATCCAAGCCATCAACGGCGAGAGCACTGAGCTCATGACACACCTGGAGGCCC AGAACCGCATTAAAGGCTGCCACGATCATCTTACGCTCTCGGTCAGCAGGCCTGAGAATAAGAACTGGCC CAGTGCTCCTGATGACAAGGCTCAAGCACATAGGATCCACATTGACCCTGAGTCCCAGGACTGCAGTCCA GCCACCAGCAGGCGCTCCTCAGTCTCTGGGATTAGTCTGGAGGACAACAGATCGGGCCTGGGATCTCCAT ATGGTCAGCCACCTCGCCTTCCAGTCCCTCACAATGGCAGCAGCAACGAGGCCACCCTGCCAGCCCAGAT GAGCGCTCTGCATGTGTCTCCACCCACCAGTGCCGACACAGCCAGGGTTCTCCCTCGGAACCGGGACTGC AGGGTAGACCTGGGTTCAGAGGTATACAGGATGTTAAGGGAGCCAGCAGAGCCCACAGCCTCGGAGCCGA AACAGTCAGGATCCTTCCGCTACCTGCAGGGCATGCTAGAGGCTGGCGAGGGCGGGGATCGGCCTGGGTC TGGTGGTCCCCGGAACCTCAAACCAGCAGCCAGCAAGCTCGGTGCTCCACTGAGTGGCCTGCAGGGGCTA CCAGAGTGCACGCGCTGCGGCCACGGGATCGTGGGAACCATTGTCAAGGCGAGAGACAAGCTCTACCATC CGGAGTGCTTCATGTGCAGCGACTGCGGCCTGAATCTCAAACAGCGTGGGTACTTCTTCCTAGATGAACG GCTGTACTGTGAGAATCACGCCAAGGCTCGAGTCAAGCCGCCGGAGGGATATGATGTGGTGGCTGTATAC CCCAATGCTAAGGTGGAACTTGTCTGAGCTGGAAAATCTTGTCTTGCCTCTGCTTCACTTAATGTTCCCT CATGGCCTGTGTAAATATATGTCCTCCTGGCCTTTCTAATAAAGTCCTTCTGCTTGCTCTGAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | EcoRI-NotI |
ACCN | NM_019417 |
Insert Size | 993 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC030068, AAH30068 |
RefSeq Size | 1143 bp |
RefSeq ORF | 993 bp |
Locus ID | 30794 |
UniProt ID | P70271 |
Gene Summary | Suppresses SRC activation by recognizing and binding to active SRC and facilitating PTPN13-mediated dephosphorylation of SRC 'Tyr-419' leading to its inactivation. Inactivated SRC dissociates from this protein allowing the initiation of a new SRC inactivation cycle. Involved in reorganization of the actin cytoskeleton (By similarity). In nonmuscle cells, binds to ACTN1 (alpha-actinin-1), increases the affinity of ACTN1 to F-actin (filamentous actin), and promotes formation of actin stress fibers. Involved in regulation of the synaptic AMPA receptor transport in dendritic spines of hippocampal pyramidal neurons directing the receptors toward an insertion at the postsynaptic membrane. Links endosomal surface-internalized GRIA1-containing AMPA receptors to the alpha-actinin/actin cytoskeleton. Increases AMPA receptor-mediated excitatory postsynaptic currents in neurons (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG204849 | Pdlim4 (tGFP-tagged) - Mouse PDZ and LIM domain 4 (Pdlim4) |
CNY 2,850.00 |
|
MR204849 | Pdlim4 (Myc-DDK-tagged) - Mouse PDZ and LIM domain 4 (Pdlim4) |
CNY 2,400.00 |
|
MR204849L3 | Lenti ORF clone of Pdlim4 (Myc-DDK-tagged) - Mouse PDZ and LIM domain 4 (Pdlim4) |
CNY 4,800.00 |
|
MR204849L4 | Lenti ORF clone of Pdlim4 (mGFP-tagged) - Mouse PDZ and LIM domain 4 (Pdlim4) |
CNY 4,750.00 |