Il1rl1 (NM_010743) Mouse Untagged Clone
CAT#: MC204735
Il1rl1 (untagged) - Mouse interleukin 1 receptor-like 1 (Il1rl1), transcript variant 2, (10ug)
CNY 3,656.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | DER4; Fit-1; Ly84; St2; St2-rs1; ST2L; T1; T1/ST2 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC051445
AAGAGGTAATCCAAGATGGCTAGGACCTCTGGCTAATGTATCTACAGTGATTTCTCTTCTGGACCCTACC TCAGAGAGCACTTGTCAACCGCCTAGTGAACACACCATTACTATCCTGTGCCATTGCCATAGAGAGACCT CAGCCATCAATCACTAGCACATGATTGACAGACAGAGAATGGGACTTTGGGCTTTGGCAATTCTGACACT TCCCATGTATTTGACAGTTACGGAGGGCAGTAAATCGTCCTGGGGTCTGGAAAATGAGGCTTTAATTGTG AGATGCCCCCAAAGAGGACGCTCGACTTATCCTGTGGAATGGTATTACTCAGATACAAATGAAAGTATTC CTACTCAAAAAAGAAATCGGATCTTTGTCTCAAGAGATCGTCTGAAGTTTCTACCAGCCAGAGTGGAAGA CTCTGGGATTTATGCTTGTGTTATCAGAAGCCCCAACTTGAATAAGACTGGATACTTGAATGTCACCATA CATAAAAAGCCGCCAAGCTGCAATATCCCTGATTATTTGATGTACTCGACAGTACGTGGATCAGATAAAA ATTTCAAGATAACGTGTCCAACAATTGACCTGTATAATTGGACAGCACCTGTTCAGTGGTTTAAGAACTG CAAAGCTCTCCAAGAGCCAAGGTTCAGGGCACACAGGTCCTACTTGTTCATTGACAACGTGACTCATGAT GATGAAGGTGACTACACTTGTCAATTCACACACGCGGAGAATGGAACCAACTACATCGTGACGGCCACCA GATCATTCACAGTTGAAGAAAAAGGCTTTTCTATGTTTCCAGTAATTACAAATCCTCCATACAACCACAC AATGGAAGTGGAAATAGGAAAACCAGCAAGTATTGCCTGTTCAGCTTGCTTTGGCAAAGGCTCTCACTTC TTGGCTGATGTCCTGTGGCAGATTAACAAAACAGTAGTTGGAAATTTTGGTGAAGCAAGAATTCAAGAAG AGGAAGGTCGAAATGAAAGTTCCAGCAATGACATGGATTGTTTAACCTCAGTGTTAAGGATAACTGGTGT GACAGAAAAGGACCTGTCCCTGGAATATGACTGTCTGGCCCTGAACCTTCATGGCATGATAAGGCACACC ATAAGGCTGAGAAGGAAACAACCAAGTAAGGAGTGTCCCTCACACATTGCTTGAATAAATTGGCTGAATC AGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG |
Restriction Sites | RsrII-NotI |
ACCN | NM_010743 |
Insert Size | 1014 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC051445, AAH51445 |
RefSeq Size | 1225 bp |
RefSeq ORF | 1014 bp |
Locus ID | 17082 |
UniProt ID | P14719 |
Gene Summary | Receptor for interleukin-33 (IL-33); signaling requires association of the coreceptor IL1RAP (PubMed:18450470, PubMed:17675517). Its stimulation recruits MYD88, IRAK1, IRAK4, and TRAF6, followed by phosphorylation of MAPK3/ERK1 and/or MAPK1/ERK2, MAPK14, and MAPK8 (By similarity). Possibly involved in helper T-cell function.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks several exons, and its 3' terminal exon extends past a splice site that is used in variant 1. This results in a novel 3' coding region and 3' UTR compared to variant 1. The encoded isoform (b) has a distinct C-terminus and is shorter than isoform a. Variants 2 and 3 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
IL-33trap is a novel IL-33 neutralizing biologic that inhibits allergic airway inflammation
,Holgado, A;Braun, H;Van Nuffel, E;Detry, S;Schuijs, MJ;Deswarte, K;Vergote, K;Haegman, M;Baudelet, G;Haustraete, J;Hammad, H;Lambrecht, BN;Savvides, SN;Afonina, IS;Beyaert, R;,
J. Allergy Clin. Immunol.
,PubMed ID 30876911
[IL1RL1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG205016 | Il1rl1 (tGFP-tagged) - Mouse interleukin 1 receptor-like 1 (Il1rl1), transcript variant 2 |
CNY 3,710.00 |
|
MR205016 | Il1rl1 (Myc-DDK-tagged) - Mouse interleukin 1 receptor-like 1 (Il1rl1), transcript variant 2 |
CNY 3,656.00 |
|
MR205016L3 | Lenti ORF clone of Il1rl1 (Myc-DDK-tagged) - Mouse interleukin 1 receptor-like 1 (Il1rl1), transcript variant 2 |
CNY 6,056.00 |
|
MR205016L4 | Lenti ORF clone of Il1rl1 (mGFP-tagged) - Mouse interleukin 1 receptor-like 1 (Il1rl1), transcript variant 2 |
CNY 6,056.00 |