United States
Germany
Japan
United Kingdom
China
Acta2 (NM_007392) Mouse Untagged Clone
CAT＃: MC204777
Acta2 (untagged) - Mouse actin, alpha 2, smooth muscle, aorta (Acta2), (10ug)
CNY 5,488.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 0610041G09Rik; a-; a-SMA; Ac; Actvs; al; alphaSMA; SM; SMAalpha; SMalphaA |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC064800
GAGTGGAGAAGCCCAGCCAGTCGCTGTCAGGAACCCTGAGACGCTGCTCCAGCTATGTGTGAAGAGGAAG ACAGCACAGCCCTGGTGTGCGACAATGGTTCTGGGCTCTGTAAGGCCGGCTTCGCTGGTGATGATGCTCC CAGGGCTGTTTTCCCATCCATCGTGGGACGTCCCAGACATCAGGGAGTAATGGTTGGAATGGGCCAAAAA GACAGCTATGTGGGGGATGAAGCCCAGAGCAAGAGAGGGATCCTGACGCTGAAGTATCCGATAGAACACG GCATCATCACCAACTGGGACGACATGGAAAAGATCTGGCACCACTCTTTCTATAACGAGCTTCGTGTGGC CCCTGAAGAGCATCCGACACTGCTGACAGAGGCACCACTGAACCCTAAGGCCAACCGGGAGAAAATGACC CAGATTATGTTTGAGACCTTCAATGTCCCCGCCATGTATGTGGCTATTCAGGCTGTGCTGTCCCTCTATG CCTCTGGACGTACAACTGGTATTGTGCTGGACTCTGGAGATGGTGTGACTCACAACGTGCCTATCTATGA GGGCTATGCCCTGCCTCATGCCATCATGCGTCTGGACTTGGCTGGCCGAGATCTCACCGACTACCTCATG AAGATCCTGACTGAGCGTGGCTATTCCTTCGTGACTACTGCCGAGCGTGAGATTGTCCGTGACATCAAGG AGAAGCTGTGCTATGTAGCTCTGGACTTTGAAAATGAGATGGCCACGGCCGCCTCCTCTTCCTCCCTGGA GAAGAGCTACGAACTGCCTGACGGGCAGGTGATCACCATTGGAAACGAACGCTTCCGCTGCCCAGAGACT CTCTTCCAGCCATCTTTCATTGGGATGGAGTCAGCGGGCATCCACGAAACCACCTATAACAGCATCATGA AGTGTGATATTGACATCAGGAAGGATCTCTATGCTAACAACGTCCTGTCAGGGGGTACCACCATGTACCC AGGCATTGCTGACAGGATGCAGAAGGAGATCACAGCCCTCGCACCCAGCACCATGAAGATCAAGATCATT GCCCCTCCAGAACGCAAGTACTCTGTCTGGATCGGTGGCTCCATCCTGGCTTCGCTGTCTACCTTCCAGC AGATGTGGATCAGCAAACAGGAATACGACGAAGCTGGGCCCTCCATCGTCCACCGCAAATGCTTCTAAGT CCCCCCTGCTCTGCCTCTAGCACACAACTGTGAACGTTTTGTGGATCAGCGCCTCCAGTTCCTTTCCAAA TCATTCCTGCCCAAAGCTTTGATTTGTTACTCGTGGTTTTTTTAAAAATAAATCAGACATGTGCTACCCT TAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_007392 |
| Insert Size | 1134 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC064800, AAH64800 |
| RefSeq Size | 1354 bp |
| RefSeq ORF | 1134 bp |
| Locus ID | 11475 |
| UniProt ID | P62737 |
| Gene Summary | The protein encoded by this gene belongs to the actin family of proteins, which are highly conserved proteins that play a role in cell motility, structure and integrity. Alpha, beta and gamma actin isoforms have been identified, with alpha actins being a major constituent of the contractile apparatus, while beta and gamma actins are involved in the regulation of cell motility. This actin is an alpha actin that is found in smooth muscle. [provided by RefSeq, Feb 2021] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Smooth Muscle-Alpha Actin Inhibits Vascular Smooth Muscle Cell Proliferation and Migration by Inhibiting Rac1 Activity
,Chen, L;DeWispelaere, A;Dastvan, F;Osborne, WR;Blechner, C;Windhorst, S;Daum, G;,
PLoS ONE
,PubMed ID 27176050
[Acta2]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG205873 | Acta2 (tGFP-tagged) - Mouse actin, alpha 2, smooth muscle, aorta (Acta2) |
CNY 7,088.00 |
|
| MR205873 | Acta2 (Myc-DDK-tagged) - Mouse actin, alpha 2, smooth muscle, aorta (Acta2) |
CNY 5,488.00 |
|
| MR205873L1 | Lenti ORF clone of Acta2 (Myc-DDK-tagged) - Mouse actin, alpha 2, smooth muscle, aorta (Acta2) |
CNY 5,890.00 |
|
| MR205873L2 | Lenti ORF clone of Acta2 (mGFP-tagged) - Mouse actin, alpha 2, smooth muscle, aorta (Acta2) |
CNY 7,888.00 |
|
| MR205873L3 | Lenti ORF clone of Acta2 (Myc-DDK-tagged) - Mouse actin, alpha 2, smooth muscle, aorta (Acta2) |
CNY 5,890.00 |
|
| MR205873L4 | Lenti ORF clone of Acta2 (mGFP-tagged) - Mouse actin, alpha 2, smooth muscle, aorta (Acta2) |
CNY 5,890.00 |
