Nudt5 (NM_016918) Mouse Untagged Clone
CAT#: MC204897
Nudt5 (untagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 5 (Nudt5), (10ug)
CNY 2,400.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC049595
ACGGGTGCCTGGAGGAGGACGTGTGCACATCCTCCTTGCACCACGAGAGGCGCCGGTGTCTCTAGCGGTG GCGCCTGATTCTACGGAGACTGCAGCTTCTGCCTGATCCTTTTTCCTTTCCTCCTCAATCCCTTCCACAT CCCACAGTTTAGTGTAGCTTGAACTTTCCACCTGAGGACTGTGGAGGCCGACAAGTCGAAATGGAGACCC GAGAATCCACAGAGTCTTCTCCAGGCAAGCACCTTGTTACCTCAGAGGAGTTGATCTCAGAAGGAAAATG GGTCAAATTTGAAAAAACAACTTATATGGATCCCACTGGTAAAACCAGAACTTGGGAAACAGTGAAACTT ACAACCAGGAAGGGAAAATCTGCTGATGCCGTGTCGGTCATACCTGTGCTGCAAAGAACCCTGCACCATG AGTGCGTCATCCTGGTGAAGCAGTTCCGGCCCCCGATGGGCAGCTACTGCCTGGAGTTTCCAGCAGGGTT CATCGAAGACGGAGAAAGCCCAGAGGCGGCTGCTCTTCGGGAGCTGGAGGAAGAAACTGGCTACAAAGGT GAAGTTGCGGAATGCTCTCCAGCTGTGTGCATGGATCCAGGCTTGTCAAACTGCACCACACATGTTGTGA CAGTGACCATCAATGGAGATGATGCAGGAAATGTAAGGCCAAAACCCAAACCAGGGGATGGAGAATTTAT GGAAGTGATTTCTTTACCAAAGAATGATCTGCTGACAAGACTTGACGCTTTGGGAGCAGAACAACACCTT ACAGTGGATGCCAAGGTCTACGCCTACGGTCTGGCTCTGAAACACGCCAACTCGAAGCCATTCGAAGTGC CCTTCCTCAAATTTTAAGGCCAAGGAGGACACTGGCCATGATTTGTAAATGAAACCATGCGGCCTTCAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACCAAAAAAAAAAAAAAAAAAAAAAAAAAA AAA |
Restriction Sites | SfiI-SfiI |
ACCN | NM_016918 |
Insert Size | 657 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC049595, AAH49595 |
RefSeq Size | 1053 bp |
RefSeq ORF | 657 bp |
Locus ID | 53893 |
UniProt ID | Q9JKX6 |
Gene Summary | Enzyme that can either act as an ADP-sugar pyrophosphatase in absence of diphosphate or catalyze the synthesis of ATP in presence of diphosphate (By similarity). In absence of diphosphate, hydrolyzes with similar activities various modified nucleoside diphosphates such as ADP-ribose, ADP-mannose, ADP-glucose, 8-oxo-GDP and 8-oxo-dGDP (PubMed:10722730). Can also hydrolyze other nucleotide sugars with low activity (PubMed:10722730). In presence of diphosphate, mediates the synthesis of ATP in the nucleus by catalyzing the conversion of ADP-ribose to ATP and ribose 5-phosphate (By similarity). Nuclear ATP synthesis takes place when dephosphorylated at Thr-44 (By similarity). Nuclear ATP generation is required for extensive chromatin remodeling events that are energy-consuming (By similarity). Does not play a role in U8 snoRNA decapping activity (PubMed:21070968). Binds U8 snoRNA (PubMed:21070968).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202441 | Nudt5 (tGFP-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 5 (Nudt5) |
CNY 2,850.00 |
|
MR202441 | Nudt5 (Myc-DDK-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 5 (Nudt5) |
CNY 2,400.00 |
|
MR202441L3 | Lenti ORF clone of Nudt5 (Myc-DDK-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 5 (Nudt5) |
CNY 4,750.00 |
|
MR202441L4 | Lenti ORF clone of Nudt5 (mGFP-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 5 (Nudt5) |
CNY 4,750.00 |