United States
Germany
Japan
United Kingdom
China
Ndufa7 (NM_023202) Mouse Untagged Clone
CAT＃: MC205082
Ndufa7 (untagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7 (B14.5a) (Ndufa7), nuclear gene encoding mitochondrial protein, (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 14.5kD; 14.5kDa; 2400007M02Rik; CI-B14.5a |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC055698
GCGTCCTTCGGAGCGGAAGGAATATGGCGTCCGCTACTCGCGTTATCCAAAAGCTGCGGAACTGGGCGTC TGGGCAAGACCTGCAGGCGAAGCTACAGCTGCGCTACCAGGAGATCGCCAAGCGGACCCAGCCACCTCCG AAACTCCCCGTGGGCCCCAGTCACAAGCTGTCCAACAATTACTACTGTACTCGTGATGGCCGCCGGGAAG TTGTGCCTCCCTCAATCATCATGTCCTCACAAAAGGCCCTGGTGTCAGGCAAGGCCGCCGAGAGTTCTGC AATGGCAGCCACTGAGAAGAAGGCAGTGACACCTGCTCCTCCCATGAAGAGGTGGGAGCTGTCCAAGGAC CAGCCATACCTGTGACCCTGCCCTAGGTTACCTTGCTATATATGTCTCTAGGGCCACATGACTGCTTTTC CTCCTTGGACTCCCTCTGGGGAGAGTGTGACCTAATTTGTAACAAATATATAGAATTCCACATTAAAAAA AAAAAAAAAAAAAA |
| Restriction Sites | AscI-NotI |
| ACCN | NM_023202 |
| Insert Size | 342 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC055698, AAH55698 |
| RefSeq Size | 504 bp |
| RefSeq ORF | 342 bp |
| Locus ID | 66416 |
| UniProt ID | Q9Z1P6 |
| Gene Summary | This gene encodes a subunit of the NADH-ubiquinone oxidoreductase (complex I) enzyme, which is a large, multimeric protein. It is the first enzyme complex in the mitochondrial electron transport chain and catalyzes the transfer of electrons from NADH to the electron acceptor ubiquinone. The proton gradient created by electron transfer drives the conversion of ADP to ATP. Complex I has been biochemically separated into four fractions. The bovine ortholog of this protein has been reported to be part of the I-lambda fraction, which forms the extrinsic globular domain. In humans, deficiencies in complex I are associated with myopathies, encephalomyopathies, and neurodegenerative disorders. Pseudogenes of this gene are located on chromosomes 7 and 16. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013] Transcript Variant: This variant (1) encodes the functional protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200458 | Ndufa7 (tGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7 (B14.5a) (Ndufa7) |
CNY 2,090.00 |
|
| MR200458 | Ndufa7 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7 (B14.5a) (Ndufa7), nuclear gene encoding mitochondrial protein |
CNY 1,900.00 |
|
| MR200458L3 | Lenti ORF clone of Ndufa7 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7 (B14.5a) (Ndufa7), nuclear gene encoding mitochondrial protein |
CNY 3,800.00 |
|
| MR200458L4 | Lenti ORF clone of Ndufa7 (mGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7 (B14.5a) (Ndufa7), nuclear gene encoding mitochondrial protein |
CNY 3,800.00 |
