Rab3a (NM_009001) Mouse Untagged Clone
CAT#: MC205452
Rab3a (untagged) - Mouse RAB3A, member RAS oncogene family (Rab3a), transcript variant 2, (10ug)
CNY 2,400.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC053519
GCTAGGACTGCAGGGGCCTGAGCCTCCTCCGCTGCCGCCTGCAGCCCCCGCCGCCGCCTGCATCCCCCGC ATCCTCTTCTGGGGCCCGGTCGCCAGCGCAGTCGCCACGGTCGCCGTCGCCAGCGTTGTCTCAGCTTAGA GAGGGTAAGATGGCTTCCGCCACAGACTCTCGCTATGGGCAGAAGGAGTCCTCAGACCAGAACTTCGACT ATATGTTCAAGATCCTGATCATTGGGAACAGCAGCGTGGGCAAAACCTCGTTCCTCTTCCGCTACGCAGA TGACTCCTTCACTCCAGCCTTTGTCAGCACCGTTGGCATAGACTTCAAGGTCAAAACCATCTACCGCAAC GACAAGAGGATCAAGCTGCAGATCTGGGACACAGCAGGGCAAGAGCGGTACCGCACCATCACCACAGCCT ATTACCGAGGCGCCATGGGCTTCATCCTAATGTATGACATCACCAATGAGGAGTCATTTAATGCAGTGCA GGACTGGTCCACTCAGATCAAAACTTACTCGTGGGACAATGCCCAGGTGCTGCTGGTGGGAAACAAGTGT GACATGGAAGATGAGCGAGTGGTGTCCTCAGAGCGTGGCCGGCAGCTGGCTGACCACCTGGGCTTTGAGT TCTTTGAGGCCAGCGCCAAGGACAACATTAATGTCAAGCAGACGTTTGAACGTCTGGTGGACGTGATCTG TGAGAAGATGTCAGAGTCCCTGGATACTGCAGACCCTGCGGTCACCGGTGCCAAGCAGGGCCCGCAGCTC ACCGACCAGCAGGCGCCACCTCATCAGGATTGTGCCTGCTGAGCCACTTCCCTTCCCTGCTGCCAGGGGC ACGTCCCCCATCCCCGACTACCCTATTTATTATTGTAGCTATTTATTTATTTATTGAGGATGTGCCCCGA GCGCACCCCCTTCCCACCCTGTACATAGCTCCACCCAGCTCGGCCGTGGTGTATTGTGGTCACTGCTGCT CCCTCTCCTTTACCCCCCACCCCCATTTTGTTTTTGTAAACCATCCCGTCCACAGTTGTCAGTTGTGAAG AGGGGACCAGATGTCACTCTGCAGCAGGCTGATGGAAGATGGCGGGGCCTGCCAACCCCGAGGCTGGGGG ATCGCCATATGGACCACCTGGTTGACAGACGGCTTCTTGCTTGCCTGGGCCTTCTGCCTTATACTTTGGG ATAAATGGGGTGTAGGGGATATATTCACTACTTTGGGATACCCCCAAACCTGTTCTGACGTCGTGAGTGT CAAATGTGTCCCACTCCTCCCTAGAAGTTATGAACACTACACACAGTCAATAAAGCGAATGGACCTTGCT GAGTCTGCTGGCCCAGCCCCTGAACCCACCCACACGCAGTCCTTGACATTAAAGAGAATTTAATGAAAAA AAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_009001 |
Insert Size | 663 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC053519, AAH53519 |
RefSeq Size | 1410 bp |
RefSeq ORF | 663 bp |
Locus ID | 19339 |
UniProt ID | P63011 |
Gene Summary | Small GTP-binding protein that plays a central role in regulated exocytosis and secretion. Controls the recruitment, tethering and docking of secretory vesicles to the plasma membrane (PubMed:11598194). Upon stimulation, switches to its active GTP-bound form, cycles to vesicles and recruits effectors such as RIMS1, RIMS2, Rabphilin-3A/RPH3A, RPH3AL or SYTL4 to help the docking of vesicules onto the plasma membrane (By similarity). Upon GTP hydrolysis by GTPase-activating protein, dissociates from the vesicle membrane allowing the exocytosis to proceed (By similarity). Stimulates insulin secretion through interaction with RIMS2 isoform RIMS2 and RPH3AL effectors in pancreatic beta cells (PubMed:15159548, PubMed:20674857). Regulates calcium-dependent lysosome exocytosis and plasma membrane repair (PMR) via the interaction with 2 effectors, SYTL4 and myosin-9/MYH9 (By similarity). Acts as a positive regulator of acrosome content secretion in sperm cells by interacting with RIMS1 (By similarity). Plays a role in the regulation of dopamine release by interacting with synaptotagmin I/SYT (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) has an alternate splicing site in the 5' UTR, and is a shorter transcript, as compared to variant 1. Variants 1,2 and 3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202514 | Rab3a (tGFP-tagged) - Mouse RAB3A, member RAS oncogene family (Rab3a) |
CNY 2,850.00 |
|
MR202514 | Rab3a (Myc-DDK-tagged) - Mouse RAB3A, member RAS oncogene family (Rab3a), transcript variant 2 |
CNY 2,400.00 |
|
MR202514L3 | Lenti ORF clone of Rab3a (Myc-DDK-tagged) - Mouse RAB3A, member RAS oncogene family (Rab3a), transcript variant 2 |
CNY 4,750.00 |
|
MR202514L4 | Lenti ORF clone of Rab3a (mGFP-tagged) - Mouse RAB3A, member RAS oncogene family (Rab3a), transcript variant 2 |
CNY 4,750.00 |