United States
Germany
Japan
United Kingdom
China
Arpc3 (NM_019824) Mouse Untagged Clone
CAT＃: MC205736
Arpc3 (untagged) - Mouse actin related protein 2/3 complex, subunit 3 (Arpc3), (10ug)
CNY 2,400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1110006A04Rik; p21-Ar; p21-ARC; p21Arc |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC013618
GGCTCGGTCGTCGGAAACGCTTTCTGAGTTCGGCTTCTCTGGATCGAATCCGGACACCGTCAAGATGCCG GCATACCACTCTTCTCTCATGGACCCGGACACCAAGCTCATCGGTAACATGGCCCTGTTGCCCCTCCGAA GCCAGTTCAAAGGACCCGCCCCTCGCGAGACCAAAGACACGGACATTGTGGATGAAGCCATCTACTACTT CAAGGCCAATGTCTTCTTCAAGAACTATGAAATTAAGAATGAAGCGGACAGGACATTGATCTACATCACA CTCTACATTTCTGAGTGTCTAAAGAAACTCCAAAAGTGCAACTCCAAGAGCCAAGGCGAGAAGGAAATGT ACACGCTAGGAATCACCAACTTCCCCATCCCCGGAGAGCCTGGCTTTCCTCTCAACGCCATTTATGCCAA GCCTGCGAGCAAACAGGAGGACGAGATGATGCGTGCGTACCTCCAGCAGCTGAGGCAAGAGACCGGACTG AGGCTGTGTGAGAAGGTTTTTGACCCTCAGAGTGATAAACCCAGCAAGTGGTGGACTTGCTTTGTGAAGA GACAGTTCATGAACAAGAGTCTTTCGGGGCCTGGGCAGTGAGAGGAGCCTGGGCAGCACCATCACGTGGA GACACATCATAGGACACACAGGCCAATGTGTCTGTTCATACCTACCGTATCAAGGAGAGAAGAGAGCCTG TCTTTGCTGGAAAAGCTCTTGGTCAAGAATTGGGAGGGTGGGTGTTGGGCGATTTCGATTTTTGGCAGTT TTAAGCTGGTACTTAATATATAATAAATGTCACTGCTTATGTTAGACATTGAATTAAAACATTTTTGAGA AAAAGCTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_019824 |
| Insert Size | 537 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC013618, AAH13618 |
| RefSeq Size | 880 bp |
| RefSeq ORF | 537 bp |
| Locus ID | 56378 |
| UniProt ID | Q9JM76 |
| Gene Summary | Component of the Arp2/3 complex, a multiprotein complex that mediates actin polymerization upon stimulation by nucleation-promoting factor (NPF). The Arp2/3 complex mediates the formation of branched actin networks in the cytoplasm, providing the force for cell motility. In addition to its role in the cytoplasmic cytoskeleton, the Arp2/3 complex also promotes actin polymerization in the nucleus, thereby regulating gene transcription and repair of damaged DNA. The Arp2/3 complex promotes homologous recombination (HR) repair in response to DNA damage by promoting nuclear actin polymerization, leading to drive motility of double-strand breaks (DSBs).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201582 | Arpc3 (tGFP-tagged) - Mouse actin related protein 2/3 complex, subunit 3 (Arpc3) |
CNY 4,000.00 |
|
| MR201582 | Arpc3 (Myc-DDK-tagged) - Mouse actin related protein 2/3 complex, subunit 3 (Arpc3) |
CNY 2,400.00 |
|
| MR201582L3 | Lenti ORF clone of Arpc3 (Myc-DDK-tagged) - Mouse actin related protein 2/3 complex, subunit 3 (Arpc3) |
CNY 4,750.00 |
|
| MR201582L4 | Lenti ORF clone of Arpc3 (mGFP-tagged) - Mouse actin related protein 2/3 complex, subunit 3 (Arpc3) |
CNY 4,750.00 |
