Ccl27 (BC028511) Mouse Untagged Clone

CAT#: MC206570

Ccl27 (untagged) - Mouse chemokine (C-C motif) ligand 27 (cDNA clone MGC:41145 IMAGE:3471454), (10ug)



CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms ALP, mILC, ESkine, CTAK, CTACK, PESKY, ILC
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC028511
GCATGATGGAGGGGCTCTCCCCCGCCAGCAGCCTCCCGCTGTTACTGTTGCTTCTGAGCCCGGCTCCTGA AGCAGCCTTGCCTCTGCCCTCCAGCACTAGCTGCTGTACTCAGCTCTATAGACAGCCACTCCCAAGCAGG CTGCTGAGGAGGATTGTCCACATGGAACTGCAGGAGGCTGATGGGGACTGTCACCTCCAGGCTGTCGTGC TTCACCTGGCTCGGCGCAGTGTCTGTGTTCATCCCCAGAACCGCAGCCTGGCTCGGTGGTTAGAACGCCA AGGGAAAAGGCTCCAAGGAACTGTACCCAGTTTAAATCTGGTACTACAAAAGAAAATGTACTCACACCCC CAACAGCAAAACTAATAAAGCAACATTAGACGACAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN BC028511
Insert Size 363 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC028511, AAH28511
RefSeq Size 402 bp
RefSeq ORF 363 bp
Locus ID 20301
Gene Summary Chemotactic factor that attracts skin-associated memory T-lymphocytes. May play a role in mediating homing of lymphocytes to cutaneous sites. May play a role in cell migration during embryogenesis. Nuclear forms may facilitate cellular migration by inducing cytoskeletal relaxation. Binds to CCR10.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...