United States
Germany
Japan
United Kingdom
China
Naa10 (NM_001177965) Mouse Untagged Clone
CAT＃: MC206879
Naa10 (untagged) - Mouse N(alpha)-acetyltransferase 10, NatA catalytic subunitNalpha acetyltransferase 10 (Naa10), transcript variant 2, (10ug)
CNY 3,230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2310039H09Rik; Ard1; Ard1a; Te2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC206879
ATGAACATCCGCAATGCTAGGCCCGAAGACCTGATGAACATGCAGCACTGCAACCTTCTCTGCCTGCCGG AGAACTACCAGATGAAGTACTATTTCTATCATGGCCTCTCTTGGCCCCAGCTTTCTTACATTGCTGAGGA TGAGAATGGGAAGATTGTGGGCTACGTCTTGGCTAAAATGGAAGAGGACCCAGACGATGTGCCCCATGGA CATATCACCTCACTGGCTGTGAAGCGTTCCCACCGGCGCCTTGGCCTGGCTCAGAAGCTGATGGACCAGG CCTCTCGAGCCATGATAGAGAACTTCAATGCCAAATACGTCTCCCTGCATGTCAGGAAGAGTAACAGGGC CGCCCTGCATCTCTATTCCAACACCCTCAACTTTCAGATCAGCGAAGTGGAGCCCAAATACTATGCAGAT GGGGAAGATGCGTATGCAATGAAGCGGGACCTCACGCAGATGGCTGATGAGCCAGCCTCAGGGCCTGGCT CCTCTTGTCTCCTGTCTGGAGACTTAGGCCCTGTCTCTTTCCACCCGCTTCCCTCTGGGCTCCTGGCGGC AGCTGAGGCGGCACCTGGAGCTGAAGGAAAAGGGCAAGCACATGGTTCTGGCGGCCTTGGAGAACAAAGC GGAGAACAAAGGCAACGTGCTTCTGAGCTCAGGAGAGGCCTGTCGTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001177965 |
| Insert Size | 678 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001177965.1 |
| RefSeq Size | 1056 bp |
| RefSeq ORF | 678 bp |
| Locus ID | 56292 |
| MW | 24.8 kDa |
| Gene Summary | Catalytic subunit of the N-terminal acetyltransferase A (NatA) complex which displays alpha (N-terminal) acetyltransferase activity (PubMed:12888564). Acetylates amino termini that are devoid of initiator methionine (By similarity). The alpha (N-terminal) acetyltransferase activity may be important for vascular, hematopoietic and neuronal growth and development (By similarity). Without NAA15, displays epsilon (internal) acetyltransferase activity towards HIF1A, thereby promoting its degradation (PubMed:12464182). Represses MYLK kinase activity by acetylation, and thus represses tumor cell migration (By similarity). Acetylates, and stabilizes TSC2, thereby repressing mTOR activity and suppressing cancer development (By similarity). Acetylates HSPA1A and HSPA1B at 'Lys-77' which enhances its chaperone activity and leads to preferential binding to co-chaperone HOPX (By similarity). Acts as a negative regulator of sister chromatid cohesion during mitosis (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The resulting protein (isoform 2) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR202636 | Naa10 (Myc-DDK-tagged) - Mouse N(alpha)-acetyltransferase 10, NatA catalytic subunitNalpha acetyltransferase 10 (Naa10), transcript variant 2 |
CNY 2,400.00 |
|
| MR202636L3 | Lenti ORF clone of Naa10 (Myc-DDK-tagged) - Mouse N(alpha)-acetyltransferase 10, NatA catalytic subunitNalpha acetyltransferase 10 (Naa10), transcript variant 2 |
CNY 4,750.00 |
|
| MR202636L4 | Lenti ORF clone of Naa10 (mGFP-tagged) - Mouse N(alpha)-acetyltransferase 10, NatA catalytic subunitNalpha acetyltransferase 10 (Naa10), transcript variant 2 |
CNY 4,750.00 |
