0610038D11Rik (BC019418) Mouse Untagged Clone
CAT#: MC206914
0610038D11Rik (untagged) - Mouse RIKEN cDNA 0610038D11 gene (cDNA clone MGC:30341 IMAGE:4162006), (10ug)
CNY 3,230.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 0610038D11Rik; Trm112p |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206914 representing BC019418.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAACTGCTCACCCACAATCTCCTAAGCTCCCATGTGCGGGGCGTGGGCACGCGTGGCTTCCCGCTG CGCCTGCAGGCCACTGAGGTCCGCATCAACCCCGTGGAGTTCAACCCGGAGTTCGTGGCGCGGATGATC CCCAAAGTGGAGTGGGCGGCGCTTGTGCAGGCAGCGGACACCTTAAACTTGGCCGAGGTACCCAAAGAG CCGACTGAAGGCTATGAGCACGACGAGACATTTTTGAGGAAGATGCACCACGTGTTGCTTGAGGTGAGA ATCCTTGGGCATCGCCTGCCCAGACCTCCCACTGAGGCTACCGGTGCTTAG AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT ATCCTGGATTACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-RsrII |
ACCN | BC019418 |
Insert Size | 327 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC019418 |
RefSeq Size | 654 bp |
RefSeq ORF | 326 bp |
Locus ID | 67674 |
MW | 12.2 kDa |
Gene Summary | Acts as an activator of both rRNA/tRNA and protein methyltransferases (PubMed:26797129). Together with methyltransferase BUD23, methylates the N(7) position of a guanine in 18S rRNA (By similarity). The heterodimer with HEMK2/N6AMT1 catalyzes N5-methylation of ETF1 on 'Gln-185', using S-adenosyl L-methionine as methyl donor (PubMed:20606008, PubMed:26797129). The heterodimer with ALKBH8 catalyzes the methylation of 5-carboxymethyl uridine to 5-methylcarboxymethyl uridine at the wobble position of the anticodon loop in target tRNA species (By similarity). Involved in the pre-rRNA processing steps leading to small-subunit rRNA production (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200396 | 0610038D11Rik (tGFP-tagged) - Mouse RIKEN cDNA 0610038D11 gene (cDNA clone MGC:30341 IMAGE:4162006) |
CNY 2,850.00 |
|
MR200396 | 0610038D11Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 0610038D11 gene (cDNA clone MGC:30341 IMAGE:4162006) |
CNY 1,200.00 |
|
MR200396L3 | Lenti ORF clone of 0610038D11Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 0610038D11 gene (cDNA clone MGC:30341 IMAGE:4162006) |
CNY 4,750.00 |
|
MR200396L4 | Lenti ORF clone of 0610038D11Rik (mGFP-tagged) - Mouse RIKEN cDNA 0610038D11 gene (cDNA clone MGC:30341 IMAGE:4162006) |
CNY 4,750.00 |
其它0610038D11Rik产品