United States
Germany
Japan
United Kingdom
China
Hbxip (BC028547) Mouse Untagged Clone
CAT＃: MC206925
Hbxip (untagged) - Mouse hepatitis B virus x interacting protein (cDNA clone MGC:41446 IMAGE:1513442), (10ug)
CNY 3,230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1110003H18Rik; Hbxip; XIP |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC206925 representing BC028547.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGGCGACTTTGGAGCAGCATTTGGAGGACACAATGAAGAATCCATCCATTGTTGGAGTCCTATGC ACAGATTCACAAGGACTTAATCTGGGCTGCCGTGGTACCCTGTCGGATGAGCACGCTGGAGTCATATCT GTTCTAGCCCAGCAGGCAGCTAGGCTAACCTCTGACCCCACCGACATCCCTGTGGTATGTTTAGAATCA GATAATGGGAACATTATGATCCAGAAACACGATGGCATCACAGTGGCTGTGCACAAAATGGCCTCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | BC028547 |
| Insert Size | 276 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC028547 |
| RefSeq Size | 735 bp |
| RefSeq ORF | 275 bp |
| Locus ID | 68576 |
| MW | 9.6 kDa |
| Gene Summary | As part of the Ragulator complex it is involved in amino acid sensing and activation of mTORC1, a signaling complex promoting cell growth in response to growth factors, energy levels, and amino acids. Activated by amino acids through a mechanism involving the lysosomal V-ATPase, the Ragulator functions as a guanine nucleotide exchange factor activating the small GTPases Rag. Activated Ragulator and Rag GTPases function as a scaffold recruiting mTORC1 to lysosomes where it is in turn activated. When complexed to BIRC5, interferes with apoptosome assembly, preventing recruitment of pro-caspase-9 to oligomerized APAF1, thereby selectively suppressing apoptosis initiated via the mitochondrial/cytochrome c pathway (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200230 | Hbxip (tGFP-tagged) - Mouse hepatitis B virus x interacting protein (cDNA clone MGC:41446 IMAGE:1513442) |
CNY 2,850.00 |
|
| MR200230 | Hbxip (Myc-DDK-tagged) - Mouse hepatitis B virus x interacting protein (cDNA clone MGC:41446 IMAGE:1513442) |
CNY 1,200.00 |
|
| MR200230L3 | Lenti ORF clone of Hbxip (Myc-DDK-tagged) - Mouse hepatitis B virus x interacting protein (cDNA clone MGC:41446 IMAGE:1513442) |
CNY 4,750.00 |
|
| MR200230L4 | Lenti ORF clone of Hbxip (mGFP-tagged) - Mouse hepatitis B virus x interacting protein (cDNA clone MGC:41446 IMAGE:1513442) |
CNY 4,750.00 |
