Ins1 (NM_008386) Mouse Untagged Clone
CAT#: MC207310
Ins1 (untagged) - Mouse insulin I (Ins1), (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Ins-1; Ins2-rs1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207310 representing NM_008386
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCCTGTTGGTGCACTTCCTACCCCTGCTGGCCCTGCTTGCCCTCTGGGAGCCCAAACCCACCCAGG CTTTTGTCAAACAGCATCTTTGTGGTCCCCACCTGGTAGAGGCTCTCTACCTGGTGTGTGGGGAGCGTGG CTTCTTCTACACACCCAAGTCCCGCCGTGAAGTGGAGGACCCACAAGTGGAACAACTGGAGCTGGGAGGA AGCCCCGGGGACCTTCAGACCTTGGCGTTGGAGGTGGCCCGGCAGAAGCGTGGCATTGTGGATCAGTGCT GCACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_008386 |
Insert Size | 327 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_008386.4, NP_032412.3 |
RefSeq Size | 611 bp |
RefSeq ORF | 327 bp |
Locus ID | 16333 |
UniProt ID | P01325 |
Gene Summary | This gene encodes insulin, a peptide hormone that plays a vital role in the regulation of carbohydrate and lipid metabolism. The encoded precursor protein undergoes proteolytic cleavage to produce a disulfide-linked heterodimeric functional protein that is stored in secretory granules. An increase in blood glucose levels, among others, induces the release of insulin from the secretory granules. Mice deficient in the functional hormone encoded by this gene develop diabetes mellitus. [provided by RefSeq, Aug 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200402 | Ins1 (tGFP-tagged) - Mouse insulin I (Ins1) |
CNY 2,800.00 |
|
MR200402 | Ins1 (Myc-DDK-tagged) - Mouse insulin I (Ins1) |
CNY 1,200.00 |
|
MR200402L3 | Lenti ORF clone of Ins1 (Myc-DDK-tagged) - Mouse insulin I (Ins1) |
CNY 4,750.00 |
|
MR200402L4 | Lenti ORF clone of Ins1 (mGFP-tagged) - Mouse insulin I (Ins1) |
CNY 4,750.00 |