Prkab1 (NM_031869) Mouse Untagged Clone

CAT#: MC207357

Prkab1 (untagged) - Mouse protein kinase, AMP-activated, beta 1 non-catalytic subunit (Prkab1), (10ug)



  "NM_031869" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1300015D22Rik; AU021155; E430008F22
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207357 representing NM_031869
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCAACACGAGCAGCGAGCGCGCCGCGCTGGAGCGGCAGGCGGGCCACAAGACGCCGCGGAGGGACA
GCTCCGGGGGCGCCAAGGATGGGGACAGGCCCAAGATCCTCATGGACAGCCCTGAAGACGCCGACATCTT
CCACTCCGAAGAGATCAAGGCTCCAGAGAAAGAGGAATTCCTGGCCTGGCAGCACGACCTGGAAGCGAAT
GATAAAGCCCCCGCCCAGGCCCGGCCCACCGTGTTTCGATGGACAGGGGGTGGAAAGGAAGTCTACTTGT
CTGGGTCCTTCAACAACTGGAGCAAGCTTCCCCTCACGAGAAGCCAGAATAACTTTGTAGCCATCCTGGA
CCTGCCTGAAGGAGAGCATCAGTACAAGTTCTTCGTGGATGGACAGTGGACCCATGATCCTTCTGAGCCA
ATAGTAACCAGCCAGCTTGGCACAGTTAACAACATCATTCAAGTGAAGAAAACTGACTTTGAAGTATTTG
ATGCTTTAATGGTGGATTCCCAAAAGTGCTCCGATGTGTCTGAGCTGTCCAGCTCGCCCCCAGGACCCTA
CCACCAGGAGCCTTACATGTCTAAACCAGAAGAGAGGTTCAAAGCCCCGCCCATCCTCCCGCCACACCTG
CTGCAGGTCATCTTGAACAAGGACACGGGCATCTCTTGTGACCCAGCACTGCTTCCGGAGCCCAACCACG
TCATGCTGAACCACCTCTATGCACTCTCCATCAAGGATGGAGTGATGGTGCTCAGTGCAACACACCGGTA
CAAGAAAAAGTATGTCACCACCCTCCTCTACAAGCCGATATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_031869
Insert Size 813 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_031869.2, NP_114075.1
RefSeq Size 2051 bp
RefSeq ORF 813 bp
Locus ID 19079
UniProt ID Q9R078
Gene Summary Non-catalytic subunit of AMP-activated protein kinase (AMPK), an energy sensor protein kinase that plays a key role in regulating cellular energy metabolism. In response to reduction of intracellular ATP levels, AMPK activates energy-producing pathways and inhibits energy-consuming processes: inhibits protein, carbohydrate and lipid biosynthesis, as well as cell growth and proliferation. AMPK acts via direct phosphorylation of metabolic enzymes, and by longer-term effects via phosphorylation of transcription regulators. Also acts as a regulator of cellular polarity by remodeling the actin cytoskeleton; probably by indirectly activating myosin. Beta non-catalytic subunit acts as a scaffold on which the AMPK complex assembles, via its C-terminus that bridges alpha (PRKAA1 or PRKAA2) and gamma subunits (PRKAG1, PRKAG2 or PRKAG3) (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...