Tbp (NM_013684) Mouse Untagged Clone

CAT#: MC207415

Tbp (untagged) - Mouse TATA box binding protein (Tbp), (10ug)



  "NM_013684" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Gtf2d; GTF2D1; SCA17; TFIID
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207415 representing NM_013684
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACCAGAACAACAGCCTTCCACCTTATGCTCAGGGCTTGGCCTCCCCACAGGGCGCCATGACTCCTG
GAATTCCCATCTTTAGTCCAATGATGCCTTACGGCACAGGACTTACTCCACAGCCTATTCAGAACACCAA
CAGTCTCTCTATTTTGGAAGAGCAACAAAGACAGCAGCAGCAACAGCAACAGCAGCAGCAACAACAGCAG
GCAGTAGCAACTGCAGCAGCCTCAGTACAGCAATCAACATCTCAGCAACCCACACAGGGTGCCTCAGGCC
AGACCCCACAACTCTTCCATTCTCAAACTCTGACCACTGCACCGTTGCCAGGCACCACCCCCTTGTACCC
TTCACCAATGACTCCTATGACCCCTATCACTCCTGCCACACCAGCTTCTGAGAGCTCTGGAATTGTACCG
CAGCTTCAAAATATTGTATCTACCGTGAATCTTGGCTGTAAACTTGACCTAAAGACCATTGCACTTCGTG
CAAGAAATGCTGAATATAATCCCAAGCGATTTGCTGCAGTCATCATGAGAATAAGAGAGCCACGGACAAC
TGCGTTGATTTTCAGTTCTGGAAAAATGGTGTGCACAGGAGCCAAGAGTGAAGAACAATCCAGACTAGCA
GCAAGAAAATATGCTAGAGTTGTGCAGAAGTTGGGCTTCCCAGCTAAGTTCTTAGACTTCAAGATCCAGA
ACATGGTGGGGAGCTGTGATGTGAAGTTCCCTATAAGGCTGGAAGGCCTTGTGCTGACCCACCAGCAGTT
CAGTAGCTATGAGCCAGAATTATTTCCTGGATTAATCTACAGAATGATCAAACCCAGAATTGTTCTCCTT
ATTTTTGTTTCTGGAAAAGTTGTATTAACAGGTGCTAAAGTTAGAGCAGAGATTTATGAAGCATTTGAAA
ACATCTACCCCATCTTAAAGGGATTCAGGAAGACCACATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013684
Insert Size 951 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_013684.3, NP_038712.3
RefSeq Size 1842 bp
RefSeq ORF 951 bp
Locus ID 21374
UniProt ID P29037
Gene Summary General transcription factor that functions at the core of the DNA-binding multiprotein factor TFIID. Binding of TFIID to the TATA box is the initial transcriptional step of the pre-initiation complex (PIC), playing a role in the activation of eukaryotic genes transcribed by RNA polymerase II. Component of a BRF2-containing transcription factor complex that regulates transcription mediated by RNA polymerase III. Component of the transcription factor SL1/TIF-IB complex, which is involved in the assembly of the PIC (pre-initiation complex) during RNA polymerase I-dependent transcription. The rate of PIC formation probably is primarily dependent on the rate of association of SL1 with the rDNA promoter. SL1 is involved in stabilization of nucleolar transcription factor 1/UBTF on rDNA.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...