Ppp4c (NM_019674) Mouse Untagged Clone

CAT#: MC207523

Ppp4c (untagged) - Mouse protein phosphatase 4, catalytic subunit (Ppp4c), (10ug)



  "NM_019674" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1110002D08Rik; AU016079; Ppx
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207523 representing NM_019674
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGAGATCAGCGACCTGGACCGGCAGATCGAGCAGCTACGGCGCTGCGAGCTGATCAAAGAGAGCG
AAGTCAAGGCCCTGTGCGCCAAGGCCAGAGAAATCTTGGTAGAAGAGAGCAACGTGCAGAGGGTGGACTC
GCCAGTCACAGTATGCGGTGACATCCATGGACAATTCTATGACCTCAAGGAGCTGTTCAGAGTAGGTGGC
GATGTCCCTGAGACCAACTACCTCTTCATGGGAGACTTTGTGGACCGTGGTTTCTACAGTGTTGAAACCT
TCCTCCTCCTGCTGGCTCTTAAGGTTCGCTATCCTGACAGAATCACTTTGATCCGGGGCAATCATGAGAG
TCGCCAGATTACCCAGGTCTATGGGTTCTATGATGAGTGCTTACGGAAATATGGTTCAGTGACTGTATGG
CGCTACTGTACTGAGATCTTTGACTACCTCAGCCTGTCTGCCATCATTGATGGCAAGATCTTCTGTGTGC
ATGGAGGTCTTTCCCCTTCCATCCAGACCTTGGACCAGATCCGGACAATTGACCGAAAGCAAGAGGTACC
CCATGATGGACCCATGTGCGACCTCCTGTGGTCTGACCCTGAAGACACAACAGGCTGGGGAGTGAGCCCC
CGCGGGGCAGGTTACCTGTTTGGCAGTGACGTGGTCGCCCAGTTCAATGCAGCCAACGACATTGATATGA
TCTGCCGTGCCCACCAATTAGTGATGGAAGGCTACAAGTGGCACTTCAATGAGACCGTGCTTACTGTGTG
GTCAGCGCCTAATTACTGCTACCGCTGTGGCAATGTGGCAGCCATCTTAGAACTGGATGAGCACCTCCAG
AAAGATTTCATCATCTTCGAGGCTGCACCCCAAGAGACACGTGGCATCCCCTCCAAAAAGCCAGTGGCCG
ACTATTTCCTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_019674
Insert Size 924 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_019674.3, NP_062648.1
RefSeq Size 1332 bp
RefSeq ORF 924 bp
Locus ID 56420
UniProt ID P97470
Gene Summary Protein phosphatase that is involved in many processes such as microtubule organization at centrosomes, maturation of spliceosomal snRNPs, apoptosis, DNA repair, tumor necrosis factor (TNF)-alpha signaling, activation of c-Jun N-terminal kinase MAPK8, regulation of histone acetylation, DNA damage checkpoint signaling, NF-kappa-B activation and cell migration. The PPP4C-PPP4R1 PP4 complex may play a role in dephosphorylation and regulation of HDAC3. The PPP4C-PPP4R2-PPP4R3A PP4 complex specifically dephosphorylates H2AFX phosphorylated on Ser-140 (gamma-H2AFX) generated during DNA replication and required for DNA double strand break repair (By similarity). Dephosphorylates NDEL1 at CDK1 phosphorylation sites and negatively regulates CDK1 activity in interphase. In response to DNA damage, catalyzes RPA2 dephosphorylation, an essential step for DNA repair since it allows the efficient RPA2-mediated recruitment of RAD51 to chromatin (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...