Zfand6 (NM_022985) Mouse Untagged Clone

CAT#: MC207553

Zfand6 (untagged) - Mouse zinc finger, AN1-type domain 6 (Zfand6), (10ug)



  "NM_022985" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 3110005P07Rik; Awp1; Za20d3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207553 representing NM_022985
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTCAAGAAACTAATCACAGCCAAGCACCTATGCTTTGCTCCACTGGCTGCGGATTTTATGGAAACC
CTCGTACAAATGGCATGTGTTCAGTATGCTATAAAGAACATCTTCAAAGACAGAACAGTAGCAATGGTAG
AATAAGCCCACCTGCAGCTTCTGTCAGCAGTCTGTCTGAATCCTTACCAGTACAGTGCGCAGATGGCAGT
GTCCCAGACGCTCAGTCAGCGCTAGATTCTACGTCTTCATCTATGCAGCCAGGCCCTGTGTCAAATCAGT
CACTTTTATCAGAATCTGTAGCACCTTCCCAAGTGGACAGTACATCTGTGGACAAAGCAGTATCTGAGAC
AGAAGACCTGCAAGGACCCAGAGCAGAGGGCCTTGTTCCTCTTGAATGTGATCCTCCATCTTCAGTATCA
GATACGACACAGCAGCCATCTGAAGAGCAAAGCAAGTCTCTTGAAAAACCAAAACAAAAAAAGAATCGCT
GTTTCATGTGCAGGAAGAAAGTGGGACTTACTGGGTTTGAATGCCGGTGTGGAAATGTTTACTGTGGTGT
GCACCGTTACTCAGATGTTCACAATTGCTCTTACAATTACAAAGCTGATGCTGCTGAGAAAATCAGAAAA
GAAAATCCAGTAGTTGTTGGTGAAAAGATCCAGAAGATTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_022985
Insert Size 672 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_022985.6, NP_075361.2
RefSeq Size 1658 bp
RefSeq ORF 672 bp
Locus ID 65098
UniProt ID Q9DCH6
Gene Summary Involved in regulation of TNF-alpha induced NF-kappa-B activation and apoptosis. Involved in modulation of 'Lys-48'-linked polyubiquitination status of TRAF2 and decreases association of TRAF2 with RIPK1 (By similarity). Required for PTS1 target sequence-dependent protein import into peroxisomes and PEX5 stability; may cooperate with PEX6. In vitro involved in PEX5 export from the cytosol to peroxisomes.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) differs in the 5' UTR compared to variant 1. Variants 1-6 all encode the same isoform (a). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...