Mul1 (NM_026689) Mouse Untagged Clone

CAT#: MC207664

Mul1 (untagged) - Mouse mitochondrial ubiquitin ligase activator of NFKB 1 (Mul1), nuclear gene encoding mitochondrial protein, (10ug)



  "NM_026689" in other vectors (6)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 0610009K11Rik; AV000801; Gide
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207664 representing NM_026689
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGAGCGGTTCGCGACCGTCGCTCGGCCAGGTCATCCTGCTGGGCACCAGTTCGATGGTCACCGCCG
TACTGTACTCCATATACCGGCAGAAGGCCCAGGTCGCGCAGGAACTCAAGGGAGCTAAGAAGATTCATCT
GGGTGAAGATTTAAAGGGCATTCTTTCAGAAGCACCGGGGAAGTGTGTGCCTTATGCTGTCATCGAAGGA
GCTGTGCGGTCTGTTAAAGAAACACTCAACAGCCAGTTCGTGGAAAACTGCAAGGGGGTGATCCAGCGGC
TGTCGCTTCAGGAGCATAAGATGGTGTGGAACCGAACTACCCACCTTTGGAATGACTATTCCAAGATCAT
TCACCAGAGGACTAACACTGTGCCCTTTGACCTCGTGCCCCACGAGGACGGCGTGGCTGTGTCCGTGCGA
GTGCTGAAGCCCCTGGATTCAGTGGATCTGGGCCTAGAGACCGTGTACGAGAAGTTCCACCCCTCTGTGC
AGTCCTTCACCGATGCCATCGGCCACTACATCAGTGGCGAGAGGCCCAAAGGCATCCAGGAGACAGAGGA
GATGCTGAAGGTGGGAGCCACCCTCACGGGGATCGGTGAACTGGTCCTGGACAACAACGCTGTCCGCCTG
CAGCCCCCCAAGCAGGGCATGCAGTACTACCTGAGCAGCCAGGACTTTGACAGCCTGCTGCACAGGCAGG
AGTCTAGTGTCCGGCTCTGGAAGATTCTGGTCCTGGTGTTCGGCTTTGCTACCTGTGCCACCCTCTTCTT
CATCCTGAGGAAGCAGTACCTTCATCGGCAGGAGCGCCTGCGCCAGCAGCAGCTCCAGGAAGAGTTCCTT
GAACACGAGGCCCAGCTGCTGAGTCAAGCCTCGCCTGAGGACAGGGAGAGTCTGAAGAGCGCCTGTGTTG
TGTGTCTGAGCAACTTCAAGTCCTGTGTCTTCCTCGAGTGCGGGCATGTGTGTTCCTGCCGCCAGTGTTA
CCTTGCCTTGCCAGAGCCCAAGAGGTGCCCGATCTGTCGGCGGGAGATCACCAGGGTGATACCCTTGTAT
AACAGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_026689
Insert Size 1059 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_026689.3, NP_080965.2
RefSeq Size 3732 bp
RefSeq ORF 1059 bp
Locus ID 68350
UniProt ID Q8VCM5
Gene Summary Exhibits weak E3 ubiquitin-protein ligase activity (By similarity). E3 ubiquitin ligases accept ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfer the ubiquitin to targeted substrates (By similarity). Can ubiquitinate AKT1 preferentially at 'Lys-284' involving 'Lys-48'-linked polyubiquitination and seems to be involved in regulation of Akt signaling by targeting phosphorylated Akt to proteosomal degradation (By similarity). Proposed to preferentially act as a SUMO E3 ligase at physiological concentrations (By similarity). Plays a role in the control of mitochondrial morphology by promoting mitochondrial fragmentation, and influences mitochondrial localization (By similarity). Likely to promote mitochondrial fission through negatively regulating the mitochondrial fusion proteins MFN1 and MFN2, acting in a pathway that is parallel to the PRKN/PINK1 regulatory pathway (PubMed:24898855). May also be involved in the sumoylation of the membrane fission protein DNM1L (By similarity). Inhibits cell growth (By similarity). When overexpressed, activates JNK through MAP3K7/TAK1 and induces caspase-dependent apoptosis (By similarity). Involved in the modulation of innate immune defense against viruses by inhibiting DDX58-dependent antiviral response (By similarity). Can mediate DDX58 sumoylation and disrupt its polyubiquitination (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...