Pcgf1 (NM_197992) Mouse Untagged Clone

CAT#: MC207688

Pcgf1 (untagged) - Mouse polycomb group ring finger 1 (Pcgf1), (10ug)



  "NM_197992" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2010002K04Rik; AU024121; Nspc1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207688 representing NM_197992
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGCTTCGGAACCAGCTCCAGTCAGTGTACAAGATGGACCCACTACGGAACGAGGAGGAGGTCCGGG
TGAAGATCAAAGACCTGAATGAACACATCGTTTGCTGCCTGTGCGCGGGCTACTTCGTGGATGCCACCAC
CATCACAGAGTGTCTCCACACCTTCTGCAAAAGTTGTATCGTGAAGTACCTGCAAACCAGCAAGTACTGC
CCCATGTGCAACATCAAGATCCACGAGACGCAGCCGTTGCTCAATCTCAAACTGGATCGGGTCATGCAGG
ACATAGTGTATAAGCTAGTGCCAGGCTTGCAAGACAGTGAAGAGAAACGGATTCGGGAATTCTATCAGTC
CCGAGGCTTAGACAGAGTCTCCCAGCCCAGTGGTGAAGAGCCAGCCCTGAGCAACCTTGGCCTCCCCTTC
AGCAGTTTTGACCACTCTAAAGCCCACTATTATCGATATGATGAACAGCTGAGCCTATGCCTGGAGCGGC
TGAGTTCTGGCAAAGACAAGAATAAAAATGTCCTTCAGAACAAGTATGTTCGGTGTTCTGTGAGAGCTGA
GGTCCGCCATCTCCGAAGGGTTCTGTGTCACCGACTAATGCTAAATCCACAGCATGTACAGCTCCTTTTT
GACAATGAGGTTCTCCCAGATCACATGACAATGAAACAGCTATGGCTGTCCCGCTGGTTCGGCAAGCCAT
CTCCTTTGCTTCTCCAATACAGTGTGAAAGAGAAGAGGAGGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_197992
Insert Size 744 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_197992.1, NP_932109.1
RefSeq Size 908 bp
RefSeq ORF 744 bp
Locus ID 69837
UniProt ID Q8R023
Gene Summary Component of the Polycomb group (PcG) multiprotein BCOR complex, a complex required to maintain the transcriptionally repressive state of some genes, such as BCL6 and the cyclin-dependent kinase inhibitor, CDKN1A. Transcriptional repressor that may be targeted to the DNA by BCL6; this transcription repressor activity may be related to PKC signaling pathway. Represses CDKN1A expression by binding to its promoter, and this repression is dependent on the retinoic acid response element (RARE element). Promotes cell cycle progression and enhances cell proliferation as well. May have a positive role in tumor cell growth by down-regulating CDKN1A. Component of a Polycomb group (PcG) multiprotein PRC1-like complex, a complex class required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. PcG PRC1 complex acts via chromatin remodeling and modification of histones; it mediates monoubiquitination of histone H2A 'Lys-119', rendering chromatin heritably changed in its expressibility. Within the PRC1-like complex, regulates RNF2 ubiquitin ligase activity. Regulates the expression of DPPA4 and NANOG in the NT2 embryonic carcinoma cells.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...