Il34 (NM_001135100) Mouse Untagged Clone

CAT#: MC207762

Il34 (untagged) - Mouse interleukin 34 (Il34), transcript variant 1, (10ug)



  "NM_001135100" in other vectors (3)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2010004A03Rik; AI593503
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207762 representing NM_001135100
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCCTGGGGACTCGCCTGGCTATACTGTCTTGGGATCCTACTTGACGTGGCTTTGGGAAACGAGAATT
TGGAGATATGGACTCTGACCCAAGATAAGGAGTGTGACCTTACAGGCTACCTTCGGGGCAAGCTGCAGTA
CAAGAACCGGCTTCAGTACATGAAACATTACTTCCCCATCAACTACAGGATTGCTGTGCCTTATGAGGGG
GTACTCAGAGTGGCCAACATCACAAGGCTGCAGAAGGCTCACGTGAGTGAGCGAGAGCTTCGGTACCTGT
GGGTCTTGGTGAGTCTCAATGCCACTGAGTCTGTGATGGATGTACTTCTCGAGGGCCACCCGTCCTGGAA
GTATCTACAGGAGGTTCAGACATTGCTGGAGAACGTACAGCGGAGCCTCATGGATGTGGAGATTGGCCCT
CACGTGGAAGCTGTGTTATCTCTTCTGAGTACTCCAGGCCTAAGCCTGAAGCTGGTGCGGCCCAAAGCCT
TGCTGGACAACTGCTTCCGGGTCATGGAACTGCTGTACTGTTCTTGCTGTAAACAAAGCCCCATCTTAAA
ATGGCAGGACTGCGAGCTGCCCAGGCTCCATCCCCACAGTCCGGGGTCCTTGATGCAATGTACAGCTACA
AATGTGTACCCTTTGTCTCGGCAGACCCCCACCTCCCTGCCCGGATCCCCAAGCTCAAGCCATGGCTCGT
TGCCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001135100
Insert Size 708 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC016254, AAH16254
RefSeq Size 1726 bp
RefSeq ORF 708 bp
Locus ID 76527
UniProt ID Q8R1R4
Gene Summary Cytokine that promotes the proliferation, survival and differentiation of monocytes and macrophages. Promotes the release of proinflammatory chemokines, and thereby plays an important role in innate immunity and in inflammatory processes. Plays an important role in the regulation of osteoclast proliferation and differentiation, and in the regulation of bone resorption. Signaling via CSF1R and its downstream effectors stimulates phosphorylation of MAPK1/ERK2 AND MAPK3/ERK1 (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer protein (isoform 1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...