Ldlrap1 (NM_145554) Mouse Untagged Clone

CAT#: MC207795

Ldlrap1 (untagged) - Mouse low density lipoprotein receptor adaptor protein 1 (Ldlrap1), (10ug)



  "NM_145554" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Ldlrap1 Antibody - C-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AA691260; Arh; Arh1; ARH2; FHCB1; FHCB2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207795 representing NM_145554
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACGCGCTCAAGTCGGCGGGGCGCGCGCTAATCCGGAGCCCCAGTCTGGCCAAGCAGAGCTGGGCGG
GCGGCCGGCACCGCAAGTTGCCAGAGAACTGGACGGACACGCGGGAGACACTGCTGGAGGGCATGGTTTT
CAGCCTCAAGTACCTTGGTATGACGCTGGTGGAGCGGCCCAAGGGCGAGGAGCTGTCTGCAGCTGCTGTC
AAGAGGATCGTAGCTACAGCCAAGGCCAGCGGGAAGAAGCTGCAGAAGGTGACACTCAAGGTGTCACCCC
GGGGGATCATCCTGACCGACAGCCTCACTAGCCAGCTCATCGAGAACGTGTCCATTTACAGGATCTCCTA
CTGCACTGCAGACAAGATGCACGACAAGGTGTTCGCCTACATCGCCCAGAGCCAGCAGAACGAGAGCCTC
GAGTGCCACGCCTTCCTCTGCACCAAGCGGAAAGTGGCCCAAGCCGTCACCCTGACTGTAGCCCAAGCCT
TCAAAGTTGCCTTTGAGTTTTGGCAGGTGTCCAAGGAAGAGAAAGAGAAAAGGGAGAAAGCCAACCAGGA
AGGAGGAGACGTCCCAGGGACCCGACGGGACAGCACCCCCTCACTGAAAACCTTGGTCGCTACCGGGAAC
CTGCTGGATTTGGAAGAGGTGGCTAAGGCCCCGTTATCTACAGTCAGCGCTAATACCAACAACGTGGACG
AGACACCACGGCCTCAGGTCTTGGGCAACAACAGCGTCGTCTGGGAGCTGGATGACGGCCTGGACGAAGC
ATTTTCAAGGCTGGCGCAGTCCCGGACAAACCCTCAAGTCCTGGACACTGGACTGTCAGCACAGGACATC
CATTATGCACAGTGCTTATCGCCCACCGACTGGGACAAGCCTGACAGCAGTGGCATTGATCAAGATGATG
ACGTCTTCACCTTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_145554
Insert Size 927 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_145554.2, NP_663529.2
RefSeq Size 2671 bp
RefSeq ORF 927 bp
Locus ID 100017
UniProt ID Q8C142
Gene Summary Adapter protein (clathrin-associated sorting protein (CLASP)) required for efficient endocytosis of the LDL receptor (LDLR) in polarized cells such as hepatocytes and lymphocytes, but not in non-polarized cells (fibroblasts). May be required for LDL binding and internalization but not for receptor clustering in coated pits. May facilitate the endocytocis of LDLR and LDLR-LDL complexes from coated pits by stabilizing the interaction between the receptor and the structural components of the pits. May also be involved in the internalization of other LDLR family members. Binds to phosphoinositides, which regulate clathrin bud assembly at the cell surface. Required for trafficking of LRP2 to the endocytic recycling compartment which is necessary for LRP2 proteolysis, releasing a tail fragment which translocates to the nucleus and mediates transcriptional repression (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...