Sptssa (NM_134054) Mouse Untagged Clone
CAT#: MC207810
Sptssa (untagged) - Mouse RIKEN cDNA 1110002B05 gene (1110002B05Rik), (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110002B05Rik; AA407909; AA409588; AU041967; Ssspta |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207810 representing NM_134054
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGGCATGGCGCTGGCGCGAGCATGGAAGCAGATGTCCTGGTTCTACTACCAGTACCTGCTGGTCA CTGCGCTCTACATGCTGGAGCCCTGGGAGCGAACCGTGTTCAATTCGATGCTGGTTTCCGTGGTGGGGAT GGCCCTGTACACTGGCTACGTCTTCATGCCCCAGCACATCATGGCTATTCTGCATTACTTTGAAATTGTA CAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_134054 |
Insert Size | 216 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_134054.2, NP_598815.2 |
RefSeq Size | 1363 bp |
RefSeq ORF | 216 bp |
Locus ID | 104725 |
UniProt ID | Q8R207 |
Gene Summary | Stimulates the activity of serine palmitoyltransferase (SPT). The composition of the serine palmitoyltransferase (SPT) complex determines the substrate preference. The SPTLC1-SPTLC2-SPTSSA complex shows a strong preference for C16-CoA substrate, while the SPTLC1-SPTLC3-SPTSSA isozyme uses both C14-CoA and C16-CoA as substrates, with a slight preference for C14-CoA. Plays a role in MBOAT7 location to mitochondria-associated membranes (MAMs), may me involved in fatty acid remodeling phosphatidylinositol (PI).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200062 | Sptssa (tGFP-tagged) - Mouse RIKEN cDNA 1110002B05 gene (1110002B05Rik) |
CNY 2,850.00 |
|
MR200062 | Sptssa (Myc-DDK-tagged) - Mouse RIKEN cDNA 1110002B05 gene (1110002B05Rik) |
CNY 1,200.00 |
|
MR200062L1 | Lenti ORF clone of Sptssa (Myc-DDK-tagged) - Mouse RIKEN cDNA 1110002B05 gene (1110002B05Rik) |
CNY 3,600.00 |
|
MR200062L2 | Lenti ORF clone of Sptssa (mGFP-tagged) - Mouse RIKEN cDNA 1110002B05 gene (1110002B05Rik) |
CNY 4,750.00 |
|
MR200062L3 | Lenti ORF clone of Sptssa (Myc-DDK-tagged) - Mouse RIKEN cDNA 1110002B05 gene (1110002B05Rik) |
CNY 4,750.00 |
|
MR200062L4 | Lenti ORF clone of Sptssa (mGFP-tagged) - Mouse RIKEN cDNA 1110002B05 gene (1110002B05Rik) |
CNY 4,750.00 |