Cd47 (NM_010581) Mouse Untagged Clone
CAT#: MC208027
Cd47 (untagged) - Mouse CD47 antigen (Rh-related antigen, integrin-associated signal transducer) (Cd47), (10ug)
CNY 3,600.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 9130415E20Rik; AA407862; AI848868; AW108519; B430305P08Rik; IAP; Itgp |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208027 representing NM_010581
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTGGCCCTTGGCGGCGGCGCTGTTGCTGGGCTCCTGCTGCTGCGGTTCAGCTCAACTACTGTTTAGTA ACGTCAACTCCATAGAGTTCACTTCATGCAATGAAACTGTGGTCATCCCTTGCATCGTCCGTAATGTGGA GGCGCAAAGCACCGAAGAAATGTTTGTGAAGTGGAAGTTGAACAAATCGTATATTTTCATCTATGATGGA AATAAAAATAGCACTACTACAGATCAAAACTTTACCAGTGCAAAAATCTCAGTCTCAGACTTAATCAATG GCATTGCCTCTTTGAAAATGGATAAGCGCGATGCCATGGTGGGAAACTACACTTGCGAAGTGACAGAGTT ATCCAGAGAAGGCAAAACAGTTATAGAGCTGAAAAACCGCACGGCCTTCAACACTGACCAAGGATCAGCC TGTTCTTACGAGGAGGAGAAAGGAGGTTGCAAATTAGTTTCGTGGTTTTCTCCAAATGAAAAGATCCTCA TTGTTATTTTCCCAATTTTGGCTATACTCCTGTTCTGGGGAAAGTTTGGTATTTTAACACTCAAATATAA ATCCAGCCATACGAATAAGAGAATCATTCTGCTGCTCGTTGCCGGGCTGGTGCTCACAGTCATCGTGGTT GTTGGAGCCATCCTTCTCATCCCAGGAGAAAAGCCCGTGAAGAATGCTTCTGGACTTGGCCTCATTGTGA TCTCTACGGGGATATTAATACTACTTCAGTACAATGTGTTTATGACAGCTTTTGGAATGACCTCTTTCAC CATTGCCATATTGATCACTCAAGTGCTGGGCTACGTCCTTGCTTTGGTCGGGCTGTGTCTCTGCATCATG GCATGTGAGCCAGTGCACGGCCCCCTTTTGATTTCAGGTTTGGGGATCATAGCTCTAGCAGAACTACTTG GATTAGTTTATATGAAGTTTGTCGCTTCCAACCAGAGGACTATCCAACCTCCTAGGAATAGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_010581 |
Insert Size | 975 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC012667, AAH12667 |
RefSeq Size | 1870 bp |
RefSeq ORF | 975 bp |
Locus ID | 16423 |
UniProt ID | Q61735 |
Gene Summary | Has a role in both cell adhesion by acting as an adhesion receptor for THBS1 on platelets, and in the modulation of integrins. Plays an important role in memory formation and synaptic plasticity in the hippocampus. Receptor for SIRPA, binding to which prevents maturation of immature dendritic cells and inhibits cytokine production by mature dendritic cells. Interaction with SIRPG mediates cell-cell adhesion, enhances superantigen-dependent T-cell-mediated proliferation and costimulates T-cell activation. May play a role in membrane transport and/or integrin dependent signal transduction. May prevent premature elimination of red blood cells. May be involved in membrane permeability changes induced following virus infection (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG204706 | Cd47 (tGFP-tagged) - Mouse CD47 antigen (Rh-related antigen, integrin-associated signal transducer) (Cd47) |
CNY 5,200.00 |
|
MR204706 | Cd47 (Myc-DDK-tagged) - Mouse CD47 antigen (Rh-related antigen, integrin-associated signal transducer) (Cd47) |
CNY 3,600.00 |
|
MR204706L1 | Lenti ORF clone of Cd47 (Myc-DDK-tagged) - Mouse CD47 antigen (Rh-related antigen, integrin-associated signal transducer) (Cd47) |
CNY 6,000.00 |
|
MR204706L2 | Lenti ORF clone of Cd47 (mGFP-tagged) - Mouse CD47 antigen (Rh-related antigen, integrin-associated signal transducer) (Cd47) |
CNY 6,000.00 |
|
MR204706L3 | Lenti ORF clone of Cd47 (Myc-DDK-tagged) - Mouse CD47 antigen (Rh-related antigen, integrin-associated signal transducer) (Cd47) |
CNY 5,890.00 |
|
MR204706L4 | Lenti ORF clone of Cd47 (mGFP-tagged) - Mouse CD47 antigen (Rh-related antigen, integrin-associated signal transducer) (Cd47) |
CNY 6,000.00 |