Prkar1a (NM_021880) Mouse Untagged Clone
CAT#: MC208039
Prkar1a (untagged) - Mouse protein kinase, cAMP dependent regulatory, type I, alpha (Prkar1a), (10ug)
CNY 3,656.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1300018C22Rik; R; RIalpha; Tse; Tse-; Tse-1; Tse1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_021880, the custom clone sequence may differ by one or more nucleotides
ATGGCGTCTGGCAGTATGGCAACCAGTGAGGAAGAGCGGAGTCTCCGGGAATGCGAGCTCTATGTGCAGA AGCACAATATCCAGGCCCTGCTGAAGGACTCCATCGTGCAGCTGTGCACTACGCGGCCCGAGAGGCCCAT GGCATTCCTTCGGGAATACTTTGAGAGGTTGGAGAAGGAGGAGGCAAGACAGATTCAGTGTCTACAGAAA ACCGGCATCCGTACTGACTCGAGGGAGGACGAGATCTCTCCTCCACCCCCCAATCCAGTGGTGAAGGGCC GACGGCGCCGAGGTGCTATCAGTGCTGAAGTTTACACTGAGGAGGATGCTGCCTCCTACGTTAGAAAGGT TATTCCAAAAGATTATAAGACAATGGCTGCTTTAGCCAAGGCCATCGAAAAGAATGTGCTGTTTTCACAC CTTGATGATAACGAGAGAAGTGACATTTTTGATGCTATGTTTCCAGTCTCCTTTATTGCTGGAGAGACGG TTATTCAGCAAGGTGATGAAGGGGATAACTTCTATGTGATTGATCAAGGAGAAATGGATGTCTATGTCAA TAATGAATGGGCAACCAGTGTTGGGGAAGGAGGGAGCTTTGGAGAGCTGGCTTTGATTTATGGAACACCC AGAGCAGCCACTGTCAAAGCAAAGACAAACGTGAAACTGTGGGGCATCGACCGAGACAGCTACCGAAGAA TCCTCATGGGAAGCACTCTGCGAAAGAGGAAGATGTATGAAGAATTCCTTAGTAAAGTGTCTATTTTAGA GTCTCTGGACAAGTGGGAGCGTCTCACAGTAGCCGATGCATTGGAGCCTGTCCAGTTTGAAGATGGACAG AAGATCGTGGTGCAAGGAGAGCCGGGGGATGAGTTCTTCATCATTTTAGAGGGCACAGCTGCTGTGCTGC AGCGTCGGTCAGAAAACGAAGAATTTGTTGAAGTGGGACGACTGGGGCCTTCTGATTATTTTGGTGAAAT TGCCCTGCTGATGAATCGTCCTCGGGCTGCCACTGTGGTTGCCCGGGGCCCTTTGAAGTGCGTTAAGTTG GACCGGCCTCGGTTTGAACGCGTCCTTGGCCCGTGCTCAGACATCCTCAAGCGGAACATCCAGCAGTACA ACAGCTTCGTGTCCCTGTCCGTCTGA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_021880 |
Insert Size | 1146 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC003461, AAH03461 |
RefSeq Size | 3313 bp |
RefSeq ORF | 1146 bp |
Locus ID | 19084 |
UniProt ID | Q9DBC7 |
Gene Summary | The encoded protein is a regulatory subunit of the cAMP-dependent protein kinase (PKA) complex, which is responsible for transducing most of the cAMP signals in eukaryotic cells. The inactive PKA complex contains two regulatory and two catalytic subunits. Binding of cAMP dissociates the complex, allowing monomeric catalytic subunits to phosphorylate cytosolic proteins or induce gene expression in the nucleus. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. All five variants encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG205941 | Prkar1a (tGFP-tagged) - Mouse protein kinase, cAMP dependent regulatory, type I, alpha (Prkar1a) |
CNY 3,710.00 |
|
MR205941 | Prkar1a (Myc-DDK-tagged) - Mouse protein kinase, cAMP dependent regulatory, type I, alpha (Prkar1a) |
CNY 3,656.00 |
|
MR205941L3 | Lenti ORF clone of Prkar1a (Myc-DDK-tagged) - Mouse protein kinase, cAMP dependent regulatory, type I, alpha (Prkar1a) |
CNY 5,230.00 |
|
MR205941L4 | Lenti ORF clone of Prkar1a (mGFP-tagged) - Mouse protein kinase, cAMP dependent regulatory, type I, alpha (Prkar1a) |
CNY 5,230.00 |
其它Prkar1a产品