Prkar1a (NM_021880) Mouse Untagged Clone

CAT#: MC208039

Prkar1a (untagged) - Mouse protein kinase, cAMP dependent regulatory, type I, alpha (Prkar1a), (10ug)



  "NM_021880" in other vectors (4)

CNY 3,656.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1300018C22Rik; R; RIalpha; Tse; Tse-; Tse-1; Tse1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_021880, the custom clone sequence may differ by one or more nucleotides


ATGGCGTCTGGCAGTATGGCAACCAGTGAGGAAGAGCGGAGTCTCCGGGAATGCGAGCTCTATGTGCAGA
AGCACAATATCCAGGCCCTGCTGAAGGACTCCATCGTGCAGCTGTGCACTACGCGGCCCGAGAGGCCCAT
GGCATTCCTTCGGGAATACTTTGAGAGGTTGGAGAAGGAGGAGGCAAGACAGATTCAGTGTCTACAGAAA
ACCGGCATCCGTACTGACTCGAGGGAGGACGAGATCTCTCCTCCACCCCCCAATCCAGTGGTGAAGGGCC
GACGGCGCCGAGGTGCTATCAGTGCTGAAGTTTACACTGAGGAGGATGCTGCCTCCTACGTTAGAAAGGT
TATTCCAAAAGATTATAAGACAATGGCTGCTTTAGCCAAGGCCATCGAAAAGAATGTGCTGTTTTCACAC
CTTGATGATAACGAGAGAAGTGACATTTTTGATGCTATGTTTCCAGTCTCCTTTATTGCTGGAGAGACGG
TTATTCAGCAAGGTGATGAAGGGGATAACTTCTATGTGATTGATCAAGGAGAAATGGATGTCTATGTCAA
TAATGAATGGGCAACCAGTGTTGGGGAAGGAGGGAGCTTTGGAGAGCTGGCTTTGATTTATGGAACACCC
AGAGCAGCCACTGTCAAAGCAAAGACAAACGTGAAACTGTGGGGCATCGACCGAGACAGCTACCGAAGAA
TCCTCATGGGAAGCACTCTGCGAAAGAGGAAGATGTATGAAGAATTCCTTAGTAAAGTGTCTATTTTAGA
GTCTCTGGACAAGTGGGAGCGTCTCACAGTAGCCGATGCATTGGAGCCTGTCCAGTTTGAAGATGGACAG
AAGATCGTGGTGCAAGGAGAGCCGGGGGATGAGTTCTTCATCATTTTAGAGGGCACAGCTGCTGTGCTGC
AGCGTCGGTCAGAAAACGAAGAATTTGTTGAAGTGGGACGACTGGGGCCTTCTGATTATTTTGGTGAAAT
TGCCCTGCTGATGAATCGTCCTCGGGCTGCCACTGTGGTTGCCCGGGGCCCTTTGAAGTGCGTTAAGTTG
GACCGGCCTCGGTTTGAACGCGTCCTTGGCCCGTGCTCAGACATCCTCAAGCGGAACATCCAGCAGTACA
ACAGCTTCGTGTCCCTGTCCGTCTGA


Restriction Sites SgfI-RsrII     
ACCN NM_021880
Insert Size 1146 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC003461, AAH03461
RefSeq Size 3313 bp
RefSeq ORF 1146 bp
Locus ID 19084
UniProt ID Q9DBC7
Gene Summary The encoded protein is a regulatory subunit of the cAMP-dependent protein kinase (PKA) complex, which is responsible for transducing most of the cAMP signals in eukaryotic cells. The inactive PKA complex contains two regulatory and two catalytic subunits. Binding of cAMP dissociates the complex, allowing monomeric catalytic subunits to phosphorylate cytosolic proteins or induce gene expression in the nucleus. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. All five variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...