Yy1 (NM_009537) Mouse Untagged Clone

CAT#: MC208051

Yy1 (untagged) - Mouse YY1 transcription factor (Yy1), (10ug)



  "NM_009537" in other vectors (4)

CNY 3,990.00


货期*
6周

规格
    • 10 ug

Cited in 2 publications.

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AW488674; NF-E1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208051 representing NM_009537
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCTCGGGCGACACCCTCTACATCGCCACGGACGGCTCGGAGATGCCGGCCGAGATCGTGGAGCTGC
ATGAGATCGAGGTGGAGACCATCCCGGTGGAGACCATCGAGACCACGGTGGTGGGCGAGGAGGAGGAGGA
GGACGACGACGACGAGGACGGCGGCGGCGGCGACCACGGCGGCGGCGGGGGCGGCCACGGGCACGCCGGC
CACCACCATCACCACCACCACCACCACCACCACCACCCGCCCATGATCGCGCTGCAGCCGCTGGTGACGG
ACGACCCGACCCAAGTGCACCACCACCAGGAGGTGATCCTGGTGCAGACGCGCGAGGAGGTGGTCGGCGG
GGACGACTCGGACGGGCTGCGCGCCGAGGACGGCTTCGAGGACCAGATCCTCATCCCGGTGCCCGCGCCG
GCCGGCGGCGACGACGACTACATAGAGCAGACGCTGGTCACCGTGGCGGCGGCCGGCAAGAGCGGCGGCG
GGGCCTCGTCGGGCGGCGGTCGCGTGAAGAAGGGCGGCGGCAAGAAGAGCGGCAAGAAGAGTTACCTGGG
CGGCGGGGCCGGCGCGGCGGGCGGCGGCGGCGCCGACCCGGGGAATAAGAAGTGGGAGCAGAAGCAGGTG
CAGATCAAGACCCTGGAGGGCGAGTTCTCGGTCACCATGTGGTCCTCGGATGAAAAAAAAGATATTGACC
ATGAAACAGTGGTTGAAGAGCAGATCATTGGAGAGAACTCACCTCCTGATTATTCTGAATATATGACAGG
CAAGAAACTCCCTCCTGGAGGGATACCTGGCATTGACCTCTCAGACCCTAAGCAACTGGCAGAATTTGCC
AGAATGAAGCCAAGAAAAATTAAAGAAGATGATGCTCCAAGAACAATAGCTTGCCCTCATAAAGGCTGCA
CAAAGATGTTCAGGGATAACTCTGCTATGAGAAAGCATCTGCACACCCACGGTCCCAGAGTCCACGTCTG
TGCAGAGTGTGGCAAAGCGTTCGTTGAGAGCTCAAAGCTAAAACGACACCAGCTGGTTCATACTGGAGAA
AAGCCCTTTCAGTGCACATTCGAAGGCTGCGGGAAGCGCTTTTCACTGGACTTCAATTTGCGCACACATG
TGCGAATCCATACCGGAGACAGGCCCTATGTGTGCCCCTTCGACGGTTGTAATAAGAAGTTTGCTCAGTC
AACTAACCTGAAATCTCACATCTTAACACACGCTAAAGCCAAAAACAACCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009537
Insert Size 1245 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_009537.3, NP_033563.2
RefSeq Size 2324 bp
RefSeq ORF 1245 bp
Locus ID 22632
UniProt ID Q00899
Gene Summary Multifunctional transcription factor that exhibits positive and negative control on a large number of cellular and viral genes by binding to sites overlapping the transcription start site. Binds to the consensus sequence 5'-CCGCCATNTT-3'; some genes have been shown to contain a longer binding motif allowing enhanced binding; the initial CG dinucleotide can be methylated greatly reducing the binding affinity. The effect on transcription regulation is depending upon the context in which it binds and diverse mechanisms of action include direct activation or repression, indirect activation or repression via cofactor recruitment, or activation or repression by disruption of binding sites or conformational DNA changes. Its activity is regulated by transcription factors and cytoplasmic proteins that have been shown to abrogate or completely inhibit YY1-mediated activation or repression. Binds to the upstream conserved region (UCR) (5'-CGCCATTTT-3') of Moloney murine leukemia virus (MuLV). Acts synergistically with the SMAD1 and SMAD4 in bone morphogenetic protein (BMP)-mediated cardiac-specific gene expression (PubMed:15329343). Binds to SMAD binding elements (SBEs) (5'-GTCT/AGAC-3') within BMP response element (BMPRE) of cardiac activating regions (PubMed:15329343). Proposed to recruit the PRC2/EED-EZH2 complex to target genes that are transcriptional repressed. Involved in DNA repair. In vitro, binds to DNA recombination intermediate structures (Holliday junctions). Involved in spermatogenesis and may play a role in meiotic DNA double-strand break repair. Plays a role in regulating enhancer activation (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (2)

Other Versions

Customer Reviews 
Loading...