Snx12 (NM_018875) Mouse Untagged Clone

CAT#: MC208057

Snx12 (untagged) - Mouse sorting nexin 12 (Snx12), transcript variant 3, (10ug)



  "NM_018875" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2610001F05Rik; AW045757; SDP8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208057 representing NM_018875
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGGACACCGCAGTGGCTGACACTAGGCGCCTTAACTCGAAGCCCCAAGACCTGACCGACGCTTACG
GGCCGCCCAGTAACTTCCTGGAGATAGACATCTTTAATCCACAGACGGTGGGCGTGGGCCGCGCGCGCTT
CACCACCTATGAGGTTCGCATGCGGACAAACCTACCCATCTTCAAGCTGAAAGAATCCTGTGTACGGCGA
CGCTATAGTGACTTTGAGTGGCTGAAAAATGAGCTGGAGCGAGATAGTAAGATCGTAGTACCACCACTGC
CTGGGAAAGCCTTGAAGCGGCAGCTCCCTTTCCGAGGAGATGAAGGGATCTTTGAGGAGTCTTTCATTGA
AGAAAGGAGGCAAGGCCTCGAACAGTTTATTAACAAAATTGCTGGGCACCCACTGGCTCAGAATGAACGC
TGTCTACACATGTTCCTGCAGGAGGAGGCAATTGATAGGAACTACGTCCCTGGGAAGGTCCTTGGGGAAA
AGGATTGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_018875
Insert Size 501 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_018875.2, NP_061363.2
RefSeq Size 1000 bp
RefSeq ORF 501 bp
Locus ID 55988
UniProt ID O70493
Gene Summary May be involved in several stages of intracellular trafficking.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 3' coding region and UTR, compared to variant 1. It encodes isoform 3 which has a longer, distinct C-terminus, compared to isoform 1. An in-frame AUG is located 45 codons upstream of the annotated translation start site but is not being annotated as a start site since it is not conserved and is in a weak Kozak sequence context.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...