Arhgdib (NM_007486) Mouse Untagged Clone
CAT#: MC208151
Arhgdib (untagged) - Mouse Rho, GDP dissociation inhibitor (GDI) beta (Arhgdib), (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | D4; Gdid; Gdid4; Ly-G; Ly-GDI |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208151 representing NM_007486
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACGGAGAAGGATGCACAGCCACAGCTGGAAGAGGCGGACGACGACCTGGACAGCAAGCTCAATTATA AGCCACCCCCTCAGAAGTCCTTGAAGGAGCTGCAGGAGATGGACAAGGATGACGAGAGTCTAACCAAGTA CAAGAAAACACTGCTGGGAGATGTCCCTGTGGTAGCAGACCCAACAGTTCCCAACGTGACTGTTACCCGG CTTAGCCTTGTATGTGACAGTGCACCAGGACCCATCACCATGGACCTTACTGGCGATCTCGAGGCCCTCA AAAAGGATACATTTGTGCTAAAGGAAGGCATTGAATACAGGGTGAAAATTAACTTCAAAGTGAATAAGGA TATTGTGTCTGGCCTGAAGTATGTTCAACACACATACCGGACTGGCATGAGAGTGGATAAAGCCACATTC ATGGTTGGCAGCTATGGGCCCCGACCAGAGGAGTACGAATTCCTCACTCCAGTAGAGGAAGCTCCCAAGG GCATGCTGGCCCGAGGCACTTACCACAACAAGTCCTTCTTCACGGATGACGACAAACAGGACCACCTCAC CTGGGAATGGAACCTGGCCATTAAGAAGGATTGGACAGAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_007486 |
Insert Size | 603 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_007486.5, NP_031512.1 |
RefSeq Size | 1202 bp |
RefSeq ORF | 603 bp |
Locus ID | 11857 |
UniProt ID | Q61599 |
Gene Summary | The protein encoded by this gene is a member of the Rho guanine nucleotide dissociation inhibitor (GDI) family. This gene is expressed at high levels in hematopoietic cells. This protein is cytosolic, and dissociation of Rho from this protein is required for membrane association and activation of Rho by Guanine Nucleotide Exchange Factors (GEFs). C-terminal truncations of this gene product have been reported to promote metastasis. Multiple transcript variants and protein isoforms exist. [provided by RefSeq, Aug 2014] Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, 3 and 4 encode the longer protein, isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202044 | Arhgdib (tGFP-tagged) - Mouse Rho, GDP dissociation inhibitor (GDI) beta (Arhgdib) |
CNY 2,850.00 |
|
MR202044 | Arhgdib (Myc-DDK-tagged) - Mouse Rho, GDP dissociation inhibitor (GDI) beta (Arhgdib) |
CNY 2,400.00 |
|
MR202044L3 | Lenti ORF clone of Arhgdib (Myc-DDK-tagged) - Mouse Rho, GDP dissociation inhibitor (GDI) beta (Arhgdib) |
CNY 4,750.00 |
|
MR202044L4 | Lenti ORF clone of Arhgdib (mGFP-tagged) - Mouse Rho, GDP dissociation inhibitor (GDI) beta (Arhgdib) |
CNY 4,750.00 |
其它Arhgdib产品